What is the overall yield? You request solid phase synthesis of a 50 base-pair long DNA...
How do u solve this problem in detail ? You are tasked with using solid phase synthesis to do two consecutive coupling reactions to make a DNA-trimer. If your coupling yield is 75%, what is the overall yield for your synthesis? A 0.56396 O, B 56.3% C 0.422% D 42.2%
You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...
The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select all of the options below that are true. 1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
Suppose you are trying to synthesize DNA molecules In test tubes in the laboratory. A single stranded DNA molecule with the sequence 3'- GCGCGGAGTCCCTATCTGCA-5' will be used as the template strand for DNA synthesis. You also have at your disposal an DNA primer with the sequence 5'- CGCGCC-3', a DNA polymerase, and nucleotides You perform Iive separate experiments using the nucleotides indicated below: Experiment 1: dATP, dCTP, dGTP, and dTTP Experiment 2 dATP, dCTP. GTP, and dTTP Experiment 3 dATP,...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
4. What is the function of each component of the CRISPR-Cas9 system? (1.5 pt) PAM site: Guide RNA: Cas9: 5a. In the DNA below, the "I" line indicates where there is a mutation in a gene. Design a gRNA to find this mutation. Your gRNA will be 8 bases long and will not include the PAM sequence. Keep the following in mind: [2 pts total] i. Scan the top strand left to right and find the PAM site. ii. When...