Where does the following regulation happen? •transcriptional regulation •post-transcriptional regulation •post-translational regulation •miRNA/siRNA (mRNA degradation) •Ubiquitination/phosphorylation...
Where does the following regulation happen?
•transcriptional regulation
•post-transcriptional regulation
•post-translational regulation
•miRNA/siRNA (mRNA degradation)
•Ubiquitination/phosphorylation (protein degradation)
Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
Where does the following regulation happen?
•transcriptional regulation
•post-transcriptional regulation
•post-translational regulation
•miRNA/siRNA (mRNA degradation)
•Ubiquitination/phosphorylation...
Which of the mechanisms involving siRNA- and miRNA-based gene regulation is INCORRECT? Select one: a. Cleavage...
Which of the mechanisms involving siRNA- and miRNA-based gene regulation is INCORRECT? Select one: a. Cleavage of mRNA b. Inhibition of translation c. Post-translational modification d. Degradation of mRNA e. Transcriptional silencing
This short RNA (miRNA) is found in eukaryotic cells. miRNAs are post-transcriptional regulators that bind to...
This short RNA (miRNA) is found in eukaryotic cells. miRNAs are post-transcriptional regulators that bind to complementary sequences on target mRNAs, resulting in enhancement of mRNA degradation by nucleases and/or _________. For the study of gene functions, artificial introduction of miRNA (siRNA) is performed to cells or animals. This experimental technique is called gene silencing and or _________, compared to the gene-deleting transgenic techniques. Select one: a. transcriptional repression ;;;; Knock-Down b. translational repression ;;;; Knock-Down c. transcriptional repression ;;;;...
In eukaryotes, post-transcriptional control of gene regulation may involve Question 19 options: a. alternative mRNA splicing....
In eukaryotes, post-transcriptional control of gene regulation may involve Question 19 options: a. alternative mRNA splicing. b. alternative mRNA splicing, control of nuclear export of mRNAs to the cytoplasm, and differential mRNA degradation. c. control of nuclear export of mRNAs to the cytoplasm. d. differential mRNA degradation.
The functions of the cap on mRNA include___. A Translational start identification B RNA transcript protection...
The functions of the cap on mRNA include___. A Translational start identification B RNA transcript protection from degradation and identification of translation start site C RNA transcript protection from degradation D addition of the poly A tail splicing The following are needed for proteins to be degraded___ A proteosomes and ubiquitination B proteosome C ubiquitination D heat shock proteins If you have done the following technique where you had a specific DNA sequence by itself or that same sequence with...
1.Describe and compare eukaryotic and prokaryotic flagella. 2.Describe post-translational and cotranslational transport. 3.Describe prokaryotic mRNA translation...
1.Describe and compare eukaryotic and prokaryotic flagella. 2.Describe post-translational and cotranslational transport. 3.Describe prokaryotic mRNA translation in detail, including all steps from start to finish, including all factors. 4.Describe the molecular events involved in regulation of the lac operon in response to both glucose and lactose levels, and transcript (mRNA) abundance regulation in the prokaryotic trp operon including attenuation. 5.Completely describe transcript (mRNA) abundance regulation in the prokaryotic trp operon, and discuss whether or not the attenuation mechanism of transcriptional...
Which of the following is an example of post-translational control? A protein is phosphorylated on a...
Which of the following is an example of post-translational control? A protein is phosphorylated on a particular amino acid. An activator protein binds to an enhancer and interacts with another protein bound near the promoter. O A ribosome is prevented from binding to the mRNA. ODNA becomes tightly associated with histones.
10. 10. When considering regulation of gene expression A. miRNA/RISC complex binding will lead to degradation...
10.
10. When considering regulation of gene expression A. miRNA/RISC complex binding will lead to degradation of target mRNA. B. siRNA/RISC complex binding will halt translation of the target mRNA. C. proteins are destroyed by the proteasome using GTP energy D. labeling of proteins for destruction by the proteasome requires ATP energy 11. When comparing the epigenomes of normal and cancerous breast epithelial cells A. cancerous cells increase the methylation of genes that promote cell growth. B. cancerous cells increase...
please answer all 6 questions Question 27 3 pts TRBP is a protein important for the...
please answer all 6 questions
Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
10.Which statement regarding the transcriptional regulation of PEP carboxykinase is false A. The promoter region of...
10.Which statement regarding the transcriptional regulation of PEP carboxykinase is false A. The promoter region of the PEP carboxykinase gene has binding sites for more than a dozen transcription factors B. Transcription and degradation are the primary means of regulating PEP carboxykinase gene C . A sterol regulatory binding element protein decrease expression of the PEP carboxykinase gene D. Insulin increase expression of the PEP carboxykinase gene 11. Glycogenesis - A. Occurs only in the liver and muscle B. Begins...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
Which of the following is an example of post-translational control? A protein is phosphorylated on a particular amino acid. An activator protein binds to an enhancer and interacts with another protein bound near the promoter. O A ribosome is prevented from binding to the mRNA. ODNA becomes tightly associated with histones.
10.
10. When considering regulation of gene expression A. miRNA/RISC complex binding will lead to degradation of target mRNA. B. siRNA/RISC complex binding will halt translation of the target mRNA. C. proteins are destroyed by the proteasome using GTP energy D. labeling of proteins for destruction by the proteasome requires ATP energy 11. When comparing the epigenomes of normal and cancerous breast epithelial cells A. cancerous cells increase the methylation of genes that promote cell growth. B. cancerous cells increase...
please answer all 6 questions
Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
Most questions answered within 3 hours.
-
11.At present, the cost of the clean air and water regulations
is
A) higher then the...
asked 1 minute from now -
2. How long would it take for 1.50 mol of water at 100.0 ∘C to
be...
asked 15 minutes ago -
According to the February 2008 Federal Trade Commission report
on consumer fraud and identity theft, 23%...
asked 27 minutes ago -
Data is only as good as its completeness. And we have all dealt
with incomplete data....
asked 23 minutes ago -
Design a Class Diagram for a game of Dots and Boxes
that can do the
following:...
asked 28 minutes ago -
Describe the Christian Anfinsen’s experimentS AND explain how
they have resulted in our current understanding of...
asked 38 minutes ago -
Do a research and write about the below areas of
SPAIN country business activities (GLOBAL
BUSINESS)...
asked 40 minutes ago -
Production and operations management involves three main types
of decisions that are made at three different...
asked 42 minutes ago -
When parked, your car is 6.4 m long. Unfortunately, your garage
is only 3.9 m long....
asked 52 minutes ago -
Use Python 3 in Jupyter
Write a function called countUnique that has one parameter which
is...
asked 49 minutes ago -
The WRT Corporation makes collections on sales according to the
following schedule:
30% in month of...
asked 57 minutes ago -
2C4H18O4+13O2=8CO2+18H2O
how many atoms of oxygen are required to generate 10.3 g of
carbon dioxide?
asked 1 hour ago