1. How long would the peptide encoded by this bacterial mRNA be if it were translated...
1. How long would the peptide encoded by this bacterial mRNA be if it were translated in a eubacterial cell?
5'UAUGAGGAGGUAUGCAUGAAUCGGUAGCCUAACGGAUUCC3'
____
2. How long would the peptide encoded by this eukaryotic mRNA be if it were translated in a eukaryotic cell?
3'-mG5'5'-GUACCAUGGCCAGGAGGUGAAUGUUCCAUGCAUCGGUAGCCUAACCAACGAUUUCUGCAAAAAAAAAAAAAAAAA3'
Homework Answers
1. The length of the peptide encoded by this bacterial mRNA is 8 amino acids, because there is a stop codon at the 9th amino acid position.
Y E E V C Met N R Stop
2. The length of the peptide encoded by this eukaryotic mRNA is 12 amino acids, because there is a stop codon at the 13th amino acid position.
V P W P G G E C S Met H R Stop
Add Answer to:
1. How long would the peptide encoded by this bacterial mRNA be
if it were translated...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
What would you find encoded in the mRNA of the enzyme helicase? A nuclear localization signal...
What would you find encoded in the mRNA of the enzyme helicase? A nuclear localization signal A signal peptide Neither of the above Both of the above
Question 24 U If the transcribed mRNA using this coding strand were to be translated, the...
Question 24 U If the transcribed mRNA using this coding strand were to be translated, the first codon converted into an amino acid would be: +1 S'AGCTGGGCGCGCTTCGGTCGTCGTGATGCGCTATATAGTCTGGCGAAGCTACCGACGTAATGGCTGATGTACGT-3' CUU UAU AUG AAG
Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th...
Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th nucleotide were deleted? 5' GCU-UGU-UUA-CGA-AUU 3' Ala-Cys-Leu-Arg-Ile The entire peptide sequence would change The first amino acid would remain the same, but the others would change. None of the amino acids would change. The first two amino acids would remain the same, but the others would change. > Moving to another question will save this response.
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
Know how to calculate how long it will take an amoeba to reach a certain mass...
Know how to calculate how long it will take an amoeba to reach a certain mass (in this questions, it was the mass of an elephant, which we had to guess ourselves), we were given that the doubling time for an amoeba is 23 hours. Also, remember that the size of an amoeba is the size of an average eukaryotic cell, not a bacterial cell. Find number of proteins in an amoeba, knowing that the concentration of proteins in an...
How many amino acids are encoded by the following mRNA? 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3' The answer given by the...
How many amino acids are encoded by the following mRNA? 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3' The answer given by the book is 8, but I cant figure out why. Thanks!
Short Answers: 1. The following is an mRNA sequence; determine the peptide sequence in using the...
Short Answers: 1. The following is an mRNA sequence; determine the peptide sequence in using the genetic codon table provided above. Describe how you solve the problem. 5'-AAAGGGCGCAUGGGGAAAUGUCGCUGACGAAAUAAAAAA-3'
Consider a bacterial gene that is approximately 2100 nucleotides long. Approximately how many amino acids would...
Consider a bacterial gene that is approximately 2100 nucleotides long. Approximately how many amino acids would this gene code for? How many mRNA molecules will probably be transcribed from this gene? How many proteins will probably be made from this gene?
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
Question 24 U If the transcribed mRNA using this coding strand were to be translated, the first codon converted into an amino acid would be: +1 S'AGCTGGGCGCGCTTCGGTCGTCGTGATGCGCTATATAGTCTGGCGAAGCTACCGACGTAATGGCTGATGTACGT-3' CUU UAU AUG AAG
Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th nucleotide were deleted? 5' GCU-UGU-UUA-CGA-AUU 3' Ala-Cys-Leu-Arg-Ile The entire peptide sequence would change The first amino acid would remain the same, but the others would change. None of the amino acids would change. The first two amino acids would remain the same, but the others would change. > Moving to another question will save this response.
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
Short Answers: 1. The following is an mRNA sequence; determine the peptide sequence in using the genetic codon table provided above. Describe how you solve the problem. 5'-AAAGGGCGCAUGGGGAAAUGUCGCUGACGAAAUAAAAAA-3'
Most questions answered within 3 hours.
-
What is the purpose of the 2' hydroxyl group in RNA? What is
the reason this...
asked 4 minutes ago -
You currently have 20,000X ethidium bromide. You want to make
250 mL of 1X ethidium bromide...
asked 17 minutes ago -
What mass of lead is needed to absorb 348 J of heat if the temp
of...
asked 20 minutes ago -
Explain the difference between an auction with reserve
and an auction without reserve. if not specified,...
asked 22 minutes ago -
Write the net ionic equation for the precipitation reaction that
occurs when aqueous solutions of aluminum...
asked 25 minutes ago -
How do we find the slope distance, given the horizontal distance
and the zenith angle?
For...
asked 24 minutes ago -
The table to the right lists probabilities for the corresponding
numbers of girls in three births....
asked 35 minutes ago -
The inverse demand function for good X is P = 5−0.05Q. The
firm’s cost curve is...
asked 34 minutes ago -
The Fresh Connection is really pushing the new line of juice
products. Given that it takes...
asked 39 minutes ago -
An acute decrease in mean arterial pressure (by getting up very
quickly, for instance) will cause...
asked 38 minutes ago -
Is the pH of solutions important when using the Fluoride ISE? If
so, why?
asked 42 minutes ago -
Producer surplus is:
a.
always equal to consumer surplus.
b.
the amount paid to sellers above...
asked 43 minutes ago