Question

Short Answers: 1. The following is an mRNA sequence; determine the peptide sequence in using the genetic codon table provided
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. The following is an mRNA segnence; deterinine the Peptide sequence in using the genetic codon lable and provide above Dr DThe Genetic code table: The full set of relationships between codons and a ã (or stop signals) is called Genetie Code end insReading frame: - to reliably get from an mRNA to a protin, we need one more concept; that of reading frame, - Reading frame d

Add a comment
Know the answer?
Add Answer to:
Short Answers: 1. The following is an mRNA sequence; determine the peptide sequence in using the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume...

    using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:

  • 2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by...

    2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?

  • 2. For the following short segment of a DNA strand, complete the following table. The codon...

    2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page. Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...

  • Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of...

    Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...

  • Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a...

    Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:

  • Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...

    Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’

  • please explain answer to number 4 and 5 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE...

    please explain answer to number 4 and 5 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Song Titles Let's continue with our music analogy by reading a short gene, turning it into mRNA sequence (transcription), and then tuming the mRNA sequence into a protein (translation), which will give us a song title. This will be a small protein, which is often referred to as a "peptide." There are many peptides that are important in biological systems. Some...

  • BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed...

    BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed from a structural and mRNA: AUG CGC GOA UCC CCC ACC AGA ACG GAX UGA-3 G-C 1. Using the codon chart provided below, write down the predicted amino acid sequence of the protein the produced from this mRNA 3-UAC GCG EXU AGG GGG UGG UCU UGC COU 2). Write down the DNA sequence of the structural pene from which this mRNA sequence is transcribed...

  • Consider the following segment of DNA is part of a gene,

    Consider the following segment of DNA is part of a gene, Left  5'.... ACTGACTGACAGTC..3'        3'.... TGACTGACTGTCAG... 5'  RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...

  • 1) Using the bacterial DNA sequence that the instructor gave you:

    1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT