(1) DNA and RNA are long linear polymers, called nucleic acids, that carry information in a form that can be passed from one generation to the next. Although RNA probably functioned as the genetic material very early in evolutionary history, the genes of all modern cells and many viruses are made of DNA.
(2)
5. For the Genetic Code indicate: a) The names of the 2 different types of polymers...
different types of viruses have different nucleic acids as their genetic material.for each type, trace the flow of information from their genetic material (i.e. +RNA, -RNA, etc) to a replicated viral genome and what route is taken for expression of viral genes. what is unique about retroviruses?
Name the two different types/classes of mutations. What are the possible outcomes of a point substitution mutation? What is meant by a "degenerate" or "redundant" genetic code? How might this protect against erroneous protein production? What are the two steps in protein synthesis. What type(s) of nucleic acid are involved in each step. Why is protein synthesis important? What is an enzyme and why is it important?
The genetic code is considered degenerate because most amino acids are encoded by at least two different codons. Some researchers have hypothesized that during evolution the genetic code has been optimized for its intended use in different organisms. Reseachers can study this by examining the relationship between the frequency with which an amino acid appears in all the proteins in an organism and the total number of codons for an amino acid. An optimized organism would use amino acids in...
java Write an application that will show 5 different messages (no input, 5 types: error message, question message, information message, warning message and plain message). Use the welcome.java example from lecture slides. You should end up with just one file. Icon Code IDE Value JOptionPane.PLAIN MESSAGE JOptionPane.ERROR MESSAGE No icon -1 X 0 JOptionPane.INFORMATION MESSAGE 1 JOptionPane.WARNING MESSAGE 2 JOptionPane QUESTION MESSAGE 3 Write an application that will show 5 different messages (no input, 5 types: error message, question message,...
Which of the following is a mixture of two types of polymers? ● 1) cellulose 2) starch 。3) amylose 4) glycogen ed 5) chitin F3 F5 F6 F7 F8 F9 F10 F11 8868 5 8
1. What is the protein synthesized from the genetic code? 2. Does the genetic code have a 3' untranslated region? Where is it in the sequence? This sequence is the coding strand. 1st bracket = promoter, 2nd bracket = 5' untranslated region [ ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAGGAAGGTT] [CTTCCTTGGAGACAAATCCCTTACCTTCAATGGACARCAGTGAG] TGGAATGTATATGGAGCCAAGCTCCAGCCCCTGAACTTCAAGGAAAATG
60. _A_The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61. Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E. Spliceosomes,...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
List the names of any 15 different types of Computer Memories. Then sort them in ascending order based on: 1. Capacity 2. Price 3. Speed/Access Time
pour Paragraph 60. The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61.__Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E....