1. What is the protein synthesized from the genetic code?
2. Does the genetic code have a 3' untranslated region? Where is it in the sequence?
This sequence is the coding strand. 1st bracket = promoter, 2nd bracket = 5' untranslated region
[ ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAGGAAGGTT] [CTTCCTTGGAGACAAATCCCTTACCTTCAATGGACARCAGTGAG] TGGAATGTATATGGAGCCAAGCTCCAGCCCCTGAACTTCAAGGAAAATG
The 3’ UTR or untranslated region comprise of the sequence following the termination codon.
Coding strand:
5’ [ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAGGAAGGTT] [CTTCCTTGGAGACAAATCCCTTACCTTCAATGGACARCAGTGAG] TGGAATGTATATGGAGCCAAGCTCCAGCCCCTGAACTTCAAGGAAAATG 3’
mRNA:
5’ [CUUCCUUGGAGACAAAUCCCUUACCUUCAAUGGACARCAGUGAG] UGGA AUGUAUAUGGAGCCAAGCUCCAGCCCCUGA {3’-UTR-ACUUCAAGGAAAAUG} 3’
Protein:
Met-Tyr-Met-Glu-Pro-Ser-Ser-Ser-Pro
1. What is the protein synthesized from the genetic code? 2. Does the genetic code have...
Expert Q&A Done 1. Is this strand the sense strand or anti-sense strand? What is your evidence (How did you know)? So is this the template or coding strand? 2. How would you locate the general area of the promoter? Hint: what sequence would you look for? Underline the sequence and label with an (a). What sequence would you look for if the complementary strand was provided? (Always write answers in 5 to 3" unless otherwise 3. How many exons...
What additional genetic experiments would you suggest to verify that this region of cloned DNA contains a functional promoter? Select the two correct answers. -Insert the sequence downstream of the coding sequence for a protein whose expression is easy to assay and then introduce that chimeric construct into cells and assay for protein expression. -Use a known, control promoter to confirm that the protein-coding sequence is correct and that the protein can be detected in the cells used. -Sequence the...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
If the following mRNA code was synthesized, what polypeptide sequence would be synthesized? Use the attached genetic code to help you with your answer. 5' ACUGAUGCAACGCUAACAUAA 3' (use the 3-letter abbreviation for the amino acids and separate each amino acid with a "-". i.e. met-pro-phe-glu"
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
Below is the partial coding strand of DNA for a gene containing an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9, associated with the following genetic elements. Some elements may have more than one associated region. (a) The promoter region (b) The ribosome binding site (c) The ribosome binding site consensus sequence (d) The start codon (f) The expected region for the +1 transcription (where the transcript begins to be made) (g) Is this a prokaryotic...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...