Question

1. What is the protein synthesized from the genetic code? 2. Does the genetic code have...

1. What is the protein synthesized from the genetic code?

2. Does the genetic code have a 3' untranslated region? Where is it in the sequence?

This sequence is the coding strand. 1st bracket = promoter, 2nd bracket = 5' untranslated region

[ ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAGGAAGGTT] [CTTCCTTGGAGACAAATCCCTTACCTTCAATGGACARCAGTGAG] TGGAATGTATATGGAGCCAAGCTCCAGCCCCTGAACTTCAAGGAAAATG

0 0
Add a comment Improve this question Transcribed image text
Answer #1
  • The genetic information in the fragment of DNA or a gene, may be expressed by its ability to encode a specific RNA or protein.
  • The product thus generated typically “expresses” the genetic information of the gene.
  • Thus the process of transcription occurs to produce mRNA and translation to produce protein is defined as the central dogma.
  • DNA - > mRNA - > Protein
  • Transcription is the process by which DNA sequence is copied to mRNA, by enzyme RNA polymerase. Initiation of transcription involve formation of initiation complex. This involves binding of transcriptional factors on specific sequence on promoter that determines the binding of RNA polymerase, to form transcriptional initiation complex.
  • 5’ to 3’ strand of DNA serve as coding strand.
  • 3’ to 5’ strand of DNA act as template strand.
  • RNA is synthesized by complementary base pairing with the template strand.
  • Thus, the RNA will have same sequence as coding strand (only T is replaced by U) and is oriented in 5’ to 3’ direction.
  • Translation starts from the start codon sequence (AUG) and ends at Stop codons (UAG, UGA, UAA).
  • The 3’ UTR or untranslated region comprise of the sequence following the termination codon.

Coding strand:

5’ [ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAGGAAGGTT] [CTTCCTTGGAGACAAATCCCTTACCTTCAATGGACARCAGTGAG] TGGAATGTATATGGAGCCAAGCTCCAGCCCCTGAACTTCAAGGAAAATG 3’

mRNA:

5’ [CUUCCUUGGAGACAAAUCCCUUACCUUCAAUGGACARCAGUGAG] UGGA AUGUAUAUGGAGCCAAGCUCCAGCCCCUGA {3’-UTR-ACUUCAAGGAAAAUG} 3’

Protein:

Met-Tyr-Met-Glu-Pro-Ser-Ser-Ser-Pro

Add a comment
Know the answer?
Add Answer to:
1. What is the protein synthesized from the genetic code? 2. Does the genetic code have...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT