Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the...
Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence (make sure to indicate 5' and 3' ends):
(5')ATCGTACCGTTA(3')
Homework Answers
- During transcription the template strand of DNA is copied to form mRNA.
- Adenine pairs with uracil
- Thymidine pairs with adenine
- Guanine pairs with cytosine (and vice versa).
- The 2 strands are antiparallel.
- RNA is synthesised in 5' --> 3' direction.
5' ATCGTACCGTTA 3'
Or 3' ATTGCCATGCTA 5'
Therefore mRNA will be 5' UAACGGUACGAU 3'
If you found this answer helpful then please rate it. Comment if you have any problem in understanding this answer.
Add Answer to:
Write the sequence of the messenger RNA molecule synthesized
from a DNA template strand having the...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of...
Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of the template DNA strand. B. The sequence of the RNA strand is transferred to the DNA. C. RNA is synthesized using a template DNA strand. D. A double stranded RNA is synthesized using a single stranded RNA.
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
You are given the following sequence of DNA which encodes for a short protein (this is...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand....
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
6. A strand of DNA of the following sequence (isted according to convention) is synthesized: d(AGCTTCCAGCTAGCCTTA...
6. A strand of DNA of the following sequence (isted according to convention) is synthesized: d(AGCTTCCAGCTAGCCTTA a. What DNA strand would hydribize to this sequence? b. What RNA strand would hybridize to the same synthesized sequence?
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Note that one of the two halves of the DNA molecule is labeled template strand and...
Note that one of the two halves of the DNA molecule is labeled template strand and the other is the non-template strand. In protein synthesis, the RNA polymerase reads the template strand and uses it to make mRNA, filling in complementary bases. The mRNA then closely resembles the non-template strand. a. In what two significant ways do the non-template strand and the mRNA differ?
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
6. A strand of DNA of the following sequence (isted according to convention) is synthesized: d(AGCTTCCAGCTAGCCTTA a. What DNA strand would hydribize to this sequence? b. What RNA strand would hybridize to the same synthesized sequence?
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Most questions answered within 3 hours.
-
a) An alternating current I(t)=I0 Cos wt flows
through a large circular wire loop of radius...
asked 8 minutes ago -
The intensity (flux) measured from a distant star is 5.2 x 10-7
W/m2. The wavelength of...
asked 8 minutes ago -
At
target practice, a person aims the gun horizontally at a target at
distance, D, away....
asked 11 minutes ago -
Suppose babies born in a large hospital have a mean weight of
3685 grams, and a...
asked 13 minutes ago -
Which of the following has the fastest transfer rate?
a.
Fractional T1
b.
ATM
c.
T3...
asked 19 minutes ago -
Which of the following null hypotheses is used to test if five
population proportions are the...
asked 24 minutes ago -
What is the boiling point in oC of a 0.30 M solution of NaHSO4
if the...
asked 27 minutes ago -
Give a natural PDA and a CFG for the language { am bn cs dt :...
asked 30 minutes ago -
Ethanol is a commonly used for human in alcoholic human
beverages in dilute concentrations ranging from...
asked 37 minutes ago -
Hexachlorobenzene has a literature melting point of 231 ºC. What
would be a reasonable result when...
asked 50 minutes ago -
During an extraction.. What does MgSO4or Na2SO4 do? How do you
know if you have added...
asked 45 minutes ago -
Choose the best word from the the choices given to complete this
quote. "Matter tells spacetime...
asked 49 minutes ago