Note that one of the two halves of the DNA molecule is labeled template strand and...
Note that one of the two halves of the DNA molecule is labeled template strand and the other is the non-template strand. In protein synthesis, the RNA polymerase reads the template strand and uses it to make mRNA, filling in complementary bases. The mRNA then closely resembles the non-template strand.
a. In what two significant ways do the non-template strand and the mRNA differ?
Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
Note that one of the two halves of the DNA molecule is labeled
template strand and...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
Note: Write 13 Conceptual Multiple Choice Questions and Included Your Answer Key for Two Pictures Below...
Note: Write 13 Conceptual Multiple Choice Questions and
Included Your Answer Key for Two Pictures Below
Write 13 Conceptual Multiple Choice Ouestions and Included Your Answer Kev for Two Pictures Below Priming DNA synthesis Elongation of the new DNA strand Primase joins RNA DNA polymerase can only add dNTPs to a pre-existing strand Leading strand synthesis is continuous in the 5'->3' of DNA Leading strand Parental DNA Primase Okazaki fragments direction ONA polymerase adds DNA ONA polymerase DNA primase adds...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
15. The term that describes the directionality of the two strands in DNA Is A antidirectional...
15. The term that describes the directionality of the two strands in DNA Is A antidirectional B polydirectional Csemiparallel D. antiparallel E ntisequencial 16. Which of the following enzymes synthesis new DNA during DNA replication? ADNA primase B. RNA polymerase CONA polymerase D Helicase E DNA ligase 17. Which of the following enzymes generates a covalent bond between Okazaki fragments? A DNA primase B. RNA polymerase C DNA polymerase D Helicase E. DNA ligase strand. 18. During DNA replication Okazaki...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
Note: Write 13 Conceptual Multiple Choice Questions and
Included Your Answer Key for Two Pictures Below
Write 13 Conceptual Multiple Choice Ouestions and Included Your Answer Kev for Two Pictures Below Priming DNA synthesis Elongation of the new DNA strand Primase joins RNA DNA polymerase can only add dNTPs to a pre-existing strand Leading strand synthesis is continuous in the 5'->3' of DNA Leading strand Parental DNA Primase Okazaki fragments direction ONA polymerase adds DNA ONA polymerase DNA primase adds...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
15. The term that describes the directionality of the two strands in DNA Is A antidirectional B polydirectional Csemiparallel D. antiparallel E ntisequencial 16. Which of the following enzymes synthesis new DNA during DNA replication? ADNA primase B. RNA polymerase CONA polymerase D Helicase E DNA ligase 17. Which of the following enzymes generates a covalent bond between Okazaki fragments? A DNA primase B. RNA polymerase C DNA polymerase D Helicase E. DNA ligase strand. 18. During DNA replication Okazaki...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
Most questions answered within 3 hours.
-
The random variable X is exponentially distributed, where X
represents the time it takes for a...
asked 11 minutes ago -
a) Write a verilog module for 1:4 Demultiplexer using verilog
primitives.
b) Design 1-to-4 DEMUX using...
asked 6 minutes ago -
MATLAB
write a MATLAB function (1) output a third-order polynomial
function with the coefficients as the...
asked 19 minutes ago -
A z-score
communicates a raw score’s "relative standing"
under the normal curve in relation to:
asked 27 minutes ago -
An object is vibrating on a spring with the following equation
of motion:
?=(30 ??)cos((2?)/(160)?)
a)...
asked 27 minutes ago -
Vulcan Flyovers offers scenic overflights of Mount St. Helens,
the volcano in Washington State that explosively...
asked 29 minutes ago -
If organizations do not adapt fast enough and move incrementally
from the twentieth-century model to the...
asked 30 minutes ago -
A helium balloon with 2.5L of gas has a gauge pressure of 10,000
Pa. The balloon...
asked 34 minutes ago -
What is responsible for Jupiter's enormous magnetic field?
asked 50 minutes ago -
At the end of the year, a company offered to buy 5,000 units of
a product...
asked 51 minutes ago -
Implement C++ program for each of the following.
Let D = [-48, -14, -8, 0, 1,...
asked 1 hour ago -
Consider a labor market in which LD = 400 – 4W and LS = 250 +...
asked 1 hour ago