Create a single strand of DNA that can be carried through transcription and translation. It must...
Homework Answers
the three nucleotides together forms codon that can code for aminoacids.
the RNA stand formed from DNA by the process of transcription by changing the T bases into U bases. next the aminoacid chin is formed by the translation process. translation begins from the AUG codon and ends with the presence of UAA/UGA/UAG - stop codon.
the single DNA strand -
5' - ATGCCCTCACCTCGTTGA - 3'
the resulting mRNA strand -
5' - AUGCCCUCACCUCGUUGA - 3'
the resulting aminoacids
5' - Met - Pro - Ser - Pro - Arg - Stop
Add Answer to:
Create a single strand of DNA that can be carried through
transcription and translation. It must...
OnuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGA...
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of...
Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of DNA, mRNA, TRNA and/or polypeptide (AA : amino acids). Remember A codon chart can only be used for decoding a strand of mRNA Codon Chart a THrd DNA: TAC GCG CCT AGG 6GG TGG mRNA: DNA: TTC GAT TAG ATG CCG AAG mRNA: tRNA: - - DNA: mRNA:
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Which of the following is involved in both transcription and translation? A. amino acids B. DNA...
Which of the following is involved in both transcription and translation? A. amino acids B. DNA C. messenger RNA D. ribosomes E. transfer RNA
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA...
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3' end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA t...
List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA tRNA translates mRNA and adds amino acids to the growing peptide chain making a protein mRNA leaves nucleus Introns are excised from hnRNA Addition of 5' cap and poly-A tail to mRNA
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Date Per Practicing DNA Transcription and Translation For the following examples, give the appropriate sequence of DNA, mRNA, TRNA and/or polypeptide (AA : amino acids). Remember A codon chart can only be used for decoding a strand of mRNA Codon Chart a THrd DNA: TAC GCG CCT AGG 6GG TGG mRNA: DNA: TTC GAT TAG ATG CCG AAG mRNA: tRNA: - - DNA: mRNA:
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3' end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is...
Most questions answered within 3 hours.
-
3
researchers at Cambrige looked at 5,000 firms in Englans and found
that, in terms of...
asked 24 minutes ago -
In this exercise, we will be refactoring a working program. Code
refactoring is a process to...
asked 39 minutes ago -
why it is important and how it integrates within ERP? And what
the core challenges of...
asked 2 hours ago -
A strawberry farmer determines that the average weight of
individual strawberries produced by plants in his...
asked 2 hours ago -
Chargaff's results yielded a molar ratio of 0.400 for A to G in
avian tubercle bacillus...
asked 5 hours ago -
Which of the following binds ATP/ADP?
a. microfilaments
b. microtubules
c. intermediate filaments
d. microfilaments and...
asked 5 hours ago -
Assume that the situation can be expressed as a linear cost
function. Find the cost function....
asked 6 hours ago -
(Sort ArrayList) Write the following method that sorts an
ArrayList: public static > void sort(ArrayList list)...
asked 7 hours ago -
2) A 9 volt battery is connected to a parallel plate capacitor
with an initial capacitance...
asked 6 hours ago -
Prince Equipment has to decide whether to obtain $1,000,000 of
financing by: (1) selling common stock...
asked 7 hours ago -
The terms electrical and electronic have similar but
different meanings which of the following statement is...
asked 7 hours ago -
You wish to test the claim that the mean GPA of night students
is than 2.5...
asked 8 hours ago