ii) What are amino acid or other sequence aspects that appear to correlate with the half-lives...
ii) What are amino acid or other sequence aspects that appear to correlate with the half-lives of proteins? (2 pts)
Homework Answers
correlation between the nature of amino -terminus amino acid residues and protein half live has been shown for the beta -galacto-sidase protien.
B-galactosidase is a hydrolase enzyme that catalyzes the hydrolysis of B-galactosides into monosacharides, substrate of different beta-galactosidases include ganglioside GM1, lactosylceramides, lactose, and various glycoproteins.
Add Answer to:
ii) What are amino acid or other sequence aspects that appear to
correlate with the half-lives...
For each, write out the expected amino acid sequence. i. AUGAGGAGUGUUCAACUUUCGAGGGGCGAU ii. AUGAGCAGUGUUUAACUUUCGAGGGGCGAU
For each, write out the expected amino acid sequence. i. AUGAGGAGUGUUCAACUUUCGAGGGGCGAU ii. AUGAGCAGUGUUUAACUUUCGAGGGGCGAU
Differences between the amino acid sequence of human cytochrome c and that of 5 other species...
Differences between the amino acid sequence of human cytochrome c and that of 5 other species are given in the choices below. Based on this information, humans are most closely related to: a.) pigeons; 12 amino acid differences b.) frogs; 20 amino acid differences c.) fruit flies; 24 amino acid differences d.) yeast; 42 amino acid differences
Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger...
Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger RNA transfer RNA ribosomal RNA translator RNA
pulli 6) What is the sequence of amino acid specified by K-R-G-P, draw the amino acid...
pulli 6) What is the sequence of amino acid specified by K-R-G-P, draw the amino acid showing the peptide bonds, asymmetric carbon centers and planar regions.
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid...
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid sequence?
What amino acid would result from carrying out the following synthetic sequence? Make sure the amino...
What amino acid would result from carrying out the following
synthetic sequence? Make sure the amino acid has the appropriate
charges expected after aqueous workup.
Chat amino acid would result from carrying out the following synthetic seguence? Make sure the amino acid has the appropriate charges expected after aqueous workup. 1. NaO EtOH 2. Br(CH2)4NHCOCH3 3. H*, H20, A
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
Question 8 4 pts After a single base pair change, the following amino acid sequence was...
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
What is the gene sequence(FASTA format) and amino acid sequence for the CFTR gene/protein? If you...
What is the gene sequence(FASTA format) and amino acid sequence for the CFTR gene/protein? If you can provide a link to where you find this, that would be amazing!
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger RNA transfer RNA ribosomal RNA translator RNA
pulli 6) What is the sequence of amino acid specified by K-R-G-P, draw the amino acid showing the peptide bonds, asymmetric carbon centers and planar regions.
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid sequence?
What amino acid would result from carrying out the following
synthetic sequence? Make sure the amino acid has the appropriate
charges expected after aqueous workup.
Chat amino acid would result from carrying out the following synthetic seguence? Make sure the amino acid has the appropriate charges expected after aqueous workup. 1. NaO EtOH 2. Br(CH2)4NHCOCH3 3. H*, H20, A
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Most questions answered within 3 hours.
-
Hello, can someone please help me answer this question?
How much heat is absorbed by a...
asked 13 minutes ago -
A business executive has the option to invest money in two
plans: Plan A guarantees that...
asked 15 minutes ago -
. A marketing researcher conducted a survey of 25 shoppers
randomly selected at the local mall...
asked 29 minutes ago -
Create an comprehensive response to the
following:
Antimicrobial agents work on a multitude of microbes (bacteria,...
asked 31 minutes ago -
6.13 LAB: Step counter. Section 6.3.
A pedometer treats walking 2,000 steps as walking 1 mile....
asked 26 minutes ago -
(14.2) A block of mass m = 10 kg riding on a frictionless
horizontal plane is...
asked 30 minutes ago -
Use any search engine to search for articles about Starbucks
partnership with Tata Companies in India...
asked 28 minutes ago -
Let’s say that for some reason Bank Excess Reserves suddenly
increase sharply. What effect would this...
asked 37 minutes ago -
Given:
Curent Assets: $600,000
Total Assets: $2,600,000
Current Liabilities: $500,000
Total Liabilities: $1,700,000
What is the...
asked 43 minutes ago -
1. What is a “Bankster”? What is insider trading? Why is it
illegal?
2. What is...
asked 41 minutes ago -
A transverse wave on a cord is given by
D(x,t)=0.18sin(2.7x−61.0t), where Dand x are in m...
asked 47 minutes ago -
ASSIGNMENT
ANSWER ANY TWO OF THE FOLLOWING IN 2-3 PARAGRAPHS OF EACH
QUESTION.
1: Where is...
asked 46 minutes ago