ZuoTi.Pro
Question

A point mutation in DNA changes a) the locations of genes b) the number of chromosomes c) the length of some chromosomes d) t
One possible reading frame for the coding sequence 5 GUCAAAUUUGG 3 is_ a) 5GGU UUA AAC UG 3 b) 5 UCA AAU UUG 3 c) 5UUU
After transcription, a eukaryotic cell will process the RNA molecule before export from the nucleus. during the processing of
Catabolic pathways are often inhibited by ___ a) low levels of ATP b) the final products of the pathway inhibiting the activi
A large, polar molecule has low concentrations outside the cell and high concentrations inside the cell. In order to increase
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Ans 1: A single base pair of DNA (option E)

This is because a point mutation is defined as a type of mutation where a single nucleotide base of the DNA or RNA is changed either by insertion or deletion of a single base pair in the sequence of DNA or RNA. Point mutation usually occur due to mistakes the the process of DNA replication that might cause wide range of effects. Other options are not applicable because change in location of genes is related to transposable elements, a change in no. of chromosome is caused by the insertion, deletion, duplication etc, the change in the length of the chromosome and telomere length is not caused due to point mutations.

0 0
Add a comment
Know the answer?
Add Answer to:
A point mutation in DNA changes a) the locations of genes b) the number of chromosomes...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

  • Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...

    Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...

  • Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids....

    Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...

  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance!...

    Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance! (Q21-25) We have the following double-stranded DNA sequences, which codes for a 10 amino acid long protein gene. Use the codon table and answer the questions. 5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3' 3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5' 21. Which strand codes for this protein? A. top B. bottom C. both strands D. none of the above 22. If this is a eukaryotic gene, which RNA polymerase will make mRNA? A. RNA Pol I...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT