why is it important to know the complete nucleotide sequence of a pathogen in order to design (and effectively use) a PCR diagnostic test for that pathogen?
It's important for analysis of pathogenicity by particular pathogen.
1)PCR is a technique to make more copies of DNA region
2)The sequence of nucleotides coded triplets (codon)
3)PCR used because it has several applications like detecting genetic disease by knowing if a default gen is available or not.
4)determining biological parents
PCR diagnostic test of pathogen.
the PCR relies on a thermostable DNA polymerase .the mostly method used amplification a nucleic acid target DNA is extracted from the cell and denaturate into single stranded nucleic acid this type of PCR for identification of specific group of pathogen.
why is it important to know the complete nucleotide sequence of a pathogen in order to...
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded by the DNA? Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
You hypothesize that expression of Gene X, a gene for which you know the complete sequence in the organism of interest, may be an important contributor to the development of a phenotype (trait) that you study (e.g. eye development). What approach(es) would you use to manipulate the expression pattern of the gene to test your hypothesis?
Arrange the following molecules from least to most specific with respect to the original nucleotide sequence: RNA, DNA, Amino Acid, Protein Identify two structural differences between DNA and RNA. Suppose you are performing an experiment in which you must use heat to denature a double helix and create two single stranded pieces. Based on what you know about nucleotide bonding, do you think the nucleotides will all denature at the same time? Use scientific reasoning to explain why.
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Why is it important for companies to know what their cost is? What is your definition (not from the book) of process v.s. job order costing? Give a company example of each.
Design the perfect bacterial pathogen. Include in your description why/how it is successful at transmitting from host to host. What types of tactics does it use to evade killing by the immune system? The perfect pathogen should have one novel virulence factor that you designed/created. Describe how this virulence factor fits in with the other strategies used by the bacteria, and how it facilitates the bacteria’s survival and spread.
A new gene is discovered. Its sequence has a significant similarity to the sequences of known Toll Like Receptor (TLR). You then decide to investigate its properties. Which of the following experiments would allow you to test if the gene indeed functions as a TLR and is important in pathogen detection? Give your reasoning for selecting a particular strategy. a) A NF-kB knockout mouse. Antibody staining to evaluate the production of cytokines and antimicrobial peptides, compared to the wild type...
Why is it important to know the percentage of lease debt to traditional debt? Why are short-term interest rates important?
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
Why is it important to know the taxpayer’s age and eyesight?