Which of the following is used to shuttle and donate an amino group during ammonia incorporation?...
Which of the following is used to shuttle and donate an amino group during ammonia incorporation?
serine
lysine
cysteine
tryptophan
glutamate
Homework Answers
The alpha-amino group of most of the amino acids are transferred
to form Glutamate from the 
-keto glutamate. By this process ammonia ion is achieved through
Oxidative deamination of Glutamate.
Hence, the Glutamate is used to shuttle and donate an amino group during ammonia incorporation.
Add Answer to:
Which of the following is used to shuttle and donate an amino
group during ammonia incorporation?...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions?...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions? Select one: Histidine, aspartate, lysine, and serine Histidine, aspartate, glutamate, arginine, and lysine. Glutamine, asparagine, lysine, and tyrosine Histidine, aspartate, serine, and cysteine Serine, tyrosine, arginine, and cysteine
Which of the following amino acids has an aliphatic R group? Which of the following amino...
Which of the following amino acids has an aliphatic R group? Which of the following amino acids has an aliphatic R group? tyrosine, leucine ,serine cysteine asparagine
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
1. Which complication is likely as a result of a condition known as metabolic syndrome? A....
1. Which complication is likely as a result of a condition known as metabolic syndrome? A. developing resistance to insulin B. developing type 1 diabetes C. developing cardiovascular disease D. developing both cardiovascular disease and resistance to insulin E. developing both type 1 diabetes and cardiovascular disease 2. Which amino acids are coded for by a single codon? A. methionine only B. Isoleucine only C. methionine and isoleucine D. methionine and tryptophan E. methionine, isoleucine, and tryptophan 3. Ubiquitin is...
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysi...
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysine B) It is polar C) Forms disulfide bond/ cysteine D) Forms hydrogen bonds with neighbors/ alanine serine 27. All amino acids found in proteins are L-amino acids EXCEPT the achiral. A) glutamate B) Lysine C) glyeine D) Alamine 28. The plH at which the positive and negative charges of an amino acid balance each ofher is called the A) isotonic...
Fill in the blanks for each amino acid Amino Acid Properties Name of R-group Properties Amino...
Fill in the blanks for each amino acid
Amino Acid Properties Name of R-group Properties Amino Acid Type of Polarity pKa Charge at Special functional group pH-7 Properties (hn(wpp)amgies applicable) (whpee Alanine Arginine Asparagine Aspartate Carboxyl Polar 3.9 Sulfhydryl Polar N/A Forms S-S Glutamine Glutamate Histidine Isoleucine Lysine Methionine Phenylalanine Aromatic Non-Polar Absorbs G@ 280 nm N/A Proline Can be Serine Threonine Tryptophane Tyrosine Valine
There are amino acid residue at the following positions: Arginine - 136 Valine - 58 Glycine...
There are amino acid residue at the following positions: Arginine - 136 Valine - 58 Glycine - 235 Glutamate - 97 Which of the following amino acid substitutions would be least likely to affect the activity of this enzyme? Why? A. Tryptophan at position 235 B. Aspartate at position 58 C. Lysine at position 136 D. Asparagine at position 97
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
BIOCHEM: Ammonia is incorporated into amino acids via which of the following? A) glutamate B) glutamine...
BIOCHEM: Ammonia is incorporated into amino acids via which of the following? A) glutamate B) glutamine C) both A and B D) none of the above
i think it might be Glutamate, but im not sure. Someone please help!! its the last...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions? Select one: Histidine, aspartate, lysine, and serine Histidine, aspartate, glutamate, arginine, and lysine. Glutamine, asparagine, lysine, and tyrosine Histidine, aspartate, serine, and cysteine Serine, tyrosine, arginine, and cysteine
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysine B) It is polar C) Forms disulfide bond/ cysteine D) Forms hydrogen bonds with neighbors/ alanine serine 27. All amino acids found in proteins are L-amino acids EXCEPT the achiral. A) glutamate B) Lysine C) glyeine D) Alamine 28. The plH at which the positive and negative charges of an amino acid balance each ofher is called the A) isotonic...
Fill in the blanks for each amino acid
Amino Acid Properties Name of R-group Properties Amino Acid Type of Polarity pKa Charge at Special functional group pH-7 Properties (hn(wpp)amgies applicable) (whpee Alanine Arginine Asparagine Aspartate Carboxyl Polar 3.9 Sulfhydryl Polar N/A Forms S-S Glutamine Glutamate Histidine Isoleucine Lysine Methionine Phenylalanine Aromatic Non-Polar Absorbs G@ 280 nm N/A Proline Can be Serine Threonine Tryptophane Tyrosine Valine
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
Most questions answered within 3 hours.
-
The denaturation of proteins can be described by the
equilibrium
F⇌U
where F and U represent...
asked 19 minutes ago -
Please answer what the maximum and minimum force is, and the
angle on the ion is...
asked 21 minutes ago -
implement a program that reads a number of rows and a symbol.
The program will draw...
asked 27 minutes ago -
Assume that when adults with smartphones are randomly selected,
45% use them in meetings or classes....
asked 31 minutes ago -
Determine the number of formula units of
Na2SO4 and moles of oxygen contained in 8.11
moles...
asked 40 minutes ago -
Explain in steps on the following code
What would be the output when executed
using System;...
asked 48 minutes ago -
Given the information in the table, which of the following
statements is CORRECT?
Stock A
Stock...
asked 46 minutes ago -
Write MARIE assembly language programs that do the following:
Write a program that inputs an integer...
asked 50 minutes ago -
Explain an understanding of services and protocols.
Explain the job of DNS.
Explain the three email...
asked 1 hour ago -
(As soon as possible) Balance each of the following equations
according to the half-reaction method:
H2O2(aq)...
asked 1 hour ago -
A thin rod with a mass of 3.5kg and a length L=1.5 m is oriented
horizontally....
asked 1 hour ago -
Inheritance pattern in BRCA 1
Describe the inheritance pattern of BRCA 1 Is it recessive or...
asked 1 hour ago