Question
please help!!
In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing the Key to colors Adenine - blue
image.png
0 0
Add a comment Improve this question Transcribed image text
Answer #1

A per the the colour color the the serre sange str Strand sezwence will be S GAGAGA A A стст.с.с сетка, Antisense strand willthe mRNA sequence will be 5' GAGAGAAAAUCUCUCCCCUAGG 3' BECASUE IT WILL BE SJMJLAR AS THE SENSE STRAND ONLY THE DIFFERWNCE WILL BE MRNA WILL HAVE URACIL IN PLACE OF THYMINE.

Add a comment
Know the answer?
Add Answer to:
please help!! In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT