the mRNA sequence will be 5' GAGAGAAAAUCUCUCCCCUAGG 3' BECASUE IT WILL BE SJMJLAR AS THE SENSE STRAND ONLY THE DIFFERWNCE WILL BE MRNA WILL HAVE URACIL IN PLACE OF THYMINE.
please help!! In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points QUESTION 5 Basic...
1 e and 2 e 1 need help on those. ive posted this multiple times and peolle have anawered . but both times i posted they have given me two diff reaponses for the answers. please help for 1e and 2e. if u coild look at the chart and decide the sequences for me please be simple and clear 3rd base in codon puco sucopucobuco 2nd base in codon CAIG SS2288 222222233&a The Genetic Code 1st base in codon Norma...
8. Glycolysis is a(n). A) five-step B) aerobic process C) catabolic D) anaerobic 9. The overall process of glycolysis A) produces CO B) is an anabolic pathway C) uses up 4 ATP molecules. D) produces 2 ATP molecules. 10. In step 9 of glycolysis, 2-phosphoglycerate is converted to phosphoenolpyruvate by a(n) reaction ) hydrolysis D) oxidation A) elimination B) addition 11. The nucleotides in the backbone of DNA are held together by A) phosphodiester B) hydrogen bonds D) peptide C)...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...