Based on the gel image and the following information, answer the questions and fill in the table below.
Order of wells: snack 1, 100bp ladder, snack 2, positive control, negative control
Questions:
1. Did the controls work and what do they tell you?
2. Do snack 1 and snack 2 contain the 35S promoter?
3. What conclusion can you draw about the corn-based snacks tested?
Results:
sample | PCR product amplified by 35S primers (~160bp) (yes or no) | PCR product amplified by tubular primers (~190bp) (yes or no) |
GM corn | ||
Non-GM corn | ||
Corn based snack 1 | ||
Corn based snack 2 |
Tubulin is a gene found in all plants and thus, its amplification provides evidence of DNA preparation.
On the other hand, 35S promoter drives expression of many transgenes. Thus, its amplification provides evidence of transgene.
Based on the gel image and the following information, answer the questions and fill in the...
After PCR is performed the products are run out on an agarose gel. In the figure below, grey bands represent the wells the PCR product was loaded into. The white bands represent DNA fragments produced by PCR. The target fragment amplified by the primers was 1,500 bp in size. The ladder is a standard DNA ladder containing bands of various sizes between 5,000 and 1,000 bp. The negative control contained only molecular grade water*. The positive control contained DNA known...
amplify a 161 bp fragment of the vaca gene which is only found in H. pylori. You culture bacteria from gastric biopsies, extract the DNA, run the PCR, and run the gel elctrophoresis according to standard techniques. An image of the gel electrophoresis is below. 161 bp 500 bp 400 bp 300 bp 200 bp 100 bp The lanes on your gel contain the following: . M) Mass Ladder to estimate size 1) Positive Control using DNA from a lab...
Which of the following answer(s) are true (select all that apply)? a)PCR results in exclusively the desired region to be amplified. b) PCR primers must be outside the region of interest. c) PCR primers must be flanking the region of interest. d) Sequencing primers must be flanking the region of interest. e) All of the nucleotides used in Sanger Sequencing would also be able to be used for a PCR reaction where you are trying to amplify a gene of...
You are using a ChIP assay to study the positioning of a DNA-binding transcription factor (Dbp1p) on transcribed genes. You fragment DNA from wild type cells and immunoprecipitate Dbp1p with an antibody to it. Then you PCR amplify the DNA associated with Dbp1p using different sets of primers for a particular gene (G3PD). One set of primers was specific for the TATA box region of this gene, (lane 1) another pair of primers amplified the 3’ end of the open...
II. Amplify the gene of interest using the PCR, verify the PCR products on the gel electrophoresis, analyze the gel. 4. By the next morning, the PCR amplification of all the samples is over, and you set up gel electrophoresis to check for the PCR products. Results: Lane 1 Alexandra - one band Lane 2 Olga - one band Lane 3 Tatiana - one band Lane 4 Maria - one band Lane 5 Anastasia - one band Lane 6 Alexey...
Can you explain in details for this? LCN 1 C N 2 CN 3 C N 4 B LCN5 TI 181 bp 210 bp 101 bp 121 bp 95 bp Fig. 3. Agarose gel electrophoresis of PCR products amplified from genomic DNA of (A) RR-SO (IRMM-4105). Lane L, 100 bp ladder sine marker, Lane premise control: Lane N, non-GM-soy: Lane 1, EPSPS (101 bp): Lane 2, TNOS-soy genome (121 bpk Lane 3. Say genome-CaMv355 promoter (181 bpk Lane 4. EPSPS-TNOS...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
Can anyone show me step-by-step on how to do the agarose calculations? This week we will run the PCR reactions on an agarose gel and analyze the results. Safety notes: Ethidium bromide is a potent mutagen. Wear gloves when handling containers containing ethidium bromide, when handling gels that have been stained in ethidium bromide, and when working with the computer attached to the gel-doc system. Protocol I. Pouring agarose gels I. Using 10x TAE, prepare 50 ml of 3% (w/v)...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
3) Image from Biotechnology Explorer Kit, BIO RAD Analysis of DNA Fragments The data you entered for the lambda Hindill digest were the relative positions of DNA bands of known size. Since the exact size and position of these fragments are known, they can be used as standard reference points to estimate the size of unknown fragment bands. A set of fragments of known sizes is called a molecular weight ruler or standards or marker (or sometimes a ladder because...