1. What will be the mRNA sequence transcribed from a TTAAACGGCCTA template? (Remember Thymine is replaced by Uracil in RNA.)
TTAAACGGCCTA is the template
AAUUUGCCGGAU is the mRNA that is transcribed from the above template
1. What will be the mRNA sequence transcribed from a TTAAACGGCCTA template? (Remember Thymine is replaced...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'
Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA sequence below? 5' - TTACCGCTA - 3' (TEMPLATE STRAND) 3' - AATGGCGAT - 5' (CODING STRAND) 5'|TTACCGCTA | 3 5'TUAGCGGUAA3 5'UUACCGCUA13' 5'| TAGCGGTAA3
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...
Answer please?
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...
aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this DNA sequence? ots)? 10 AAU CUA G CA unU CAC Gui ACC CUA GUAU- How many codons does the sequence contain 21 th A How many amino acids make up this protein? (1 pt) List the amino acids, in order, that make up this protein using the chart provided. (5 pts) Referring to the mRNA strand constructed in Question #3, list the tRNA anti-codons...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
For each of the following DNA sequences, provide the sequence of the transcribed RNA (written from 5' to 3') and the protein translation: 1. 5'- ATGGCCCATTTTTAG-3' a. mRNA b. protein 2. 5'- ATGGCCTAGCTAAAA-3’ a. mRNA b. protein 3. 5'- TGATCAATGGCCTAG-3’ a. mRNA b. protein 4. 3º- TACGGGCTAGTTATT-5° a. mRNA b. Protein 5. Is translation an endergonic or exergonic process? Why?