Question

WORLONI ORAINES 20CLONINGENIERO - + Fit to page D Page view TULOZETLUS ) A Read aloud L Add Design forward and reverse primers (21 nucleotides) - amplify the following DNA fragment using Polymerase Chain Reaction (PCR): S'GTACCCGAGGGCTACGCTCATATTACCCTATGCATGCGCCCTACGATC GGTTCCCTAATCTCTGGCTAATCCTCTGCTTATCTTCAACTGGACTTAG CCGATTCGACGGATTAGGGCTTTATCTTACCTAATGGCTACCATTGCGC AGGTGCAGGTTACTACGGCGTTAACGGAGGCCCTTCTAATCTCGGC GCGCGCTTAATTCCGGATCCGGCCTCTC GCCGCTCTCGGAATAATCCT CCATTCTGCATATGCGCGGCTTACTAT. IAGGGTCCCTAGATTTGCTTA TATTACTAATGGGTATAACTATACCTATAGTACCCGGGTATATAGCTA GCT 3' a List down the forward and reverse primers designed. Indicate the 5' and 3' end. (2 marks) b. Using the following formula I'm = (4 *[G+C) + (2 1 + 71°C, estimate the melting temperature of your primers and establish the PCR parameters for 30 amplification cycles (10 marks) c. Determine the target size of the amplified PCR product (1 mark) (CLO4; PLO6C4) 5. Three adjacent genes for arginine biosynthesis was isolated and cloned from a bacterium. The three genes isolated make up an operon in the bacterium What do VALSTIS ham th e mes robes in Northamani

Answer 1

a. for the forward primer, initial 21 nucleotides are taken from starting of 5' end of the sequence

for reverse primer, last 21 nucleotides are taken from the 5' end or first 21 nucleotides from the 3' end and then reverse complemented to get a 5' to 3' primer

Forward primer 5'gtacccgagggctacgctcat 3'

Reverse Primer 5’ agctagctatatacccgggta 3’

b. Tm calculation

Forward primer 5'gtacccgagggctacgctcat 3'

Base count 6 a      5 c      5 g      5 t

Tm= (4*{5+5}) + (2*{6+5})

= (4*10) + (2*11) =40+22=62⁰C

Reverse Primer 5’ agctagctatatacccgggta 3’

Base count 6 a      5 c      5 g      5 t

Tm= (4*{5+5}) + (2*{6+5})

= (4*10) + (2*11) =40+22=62⁰C

As Tm for both forward and reverse primers is 62⁰C, annealing temperature to be used is Tm-5⁰C, so 62-5 =57⁰C can be used for amplification of the DNA fragment. Initial denaturation final denaturation and extension temperatures are to be used based on the enzyme used for amplification and size of amplicon. I am hereby giving you the standard conditions

Initial denaturation: 95⁰C time 5min

30 cycles steps

[final denaturation: 95⁰C time 30sec-1min

Annealing : Tm-5, 57⁰C time 30-45 secs

initial extension: 72⁰C time 1min for 1kb fragment so here it is 30 secs (as product is 343bp)]

final extension: 72⁰C time 10 min

c. the amplicon target size is 343bp.

As we are not adding any bases to the primers, the original size remains same and it is 343bp