Homework Answers
Answer- 4. Gene mutation
Protein synthesis is the synthesis of protein using RNA as a template.
Nucleic acid synthesis means Synthesis of DNA using DNA as a template (Replication) and Synthesis of RNA using DNA as a template (Transcription).
The mutations are changes in DNA sequence which can be transferred to next generation. It can be said that mutation is an error in the copying of DNA.
Please give a thumbs up!!!!!!!! Ask any doubts regarding the above question in the comment section !!!!!!!!!!! Thank you!!!!!
Add Answer to:
The information below represents a change in a portion of the base sequence in a DNA...
The transcribed portion of a DNA sequence for a gene is shown below
The transcribed portion of a DNA sequence for a gene is shown below. Identify the mRNA sequence and the polypeptide sequence that would be produced from this gene. Also, identify the specific type of DNA mutation and protein mutation that would result if the underlined A/T basepair was mutated to a C/G basepair. NOTE: Assume RNA polymerase is moving left to right across the page. 3' - TATACGCGATATGGATTC - 5 5'- ATATGCGCTATACCTAAG - 3
Will a single base pair change in a gene (DNA/RNA) always result in a change to...
Will a single base pair change in a gene (DNA/RNA) always result in a change to the protein sequence? How will a frameshift mutation at the DNA/RNA level affect the protein sequence?
How DNA Is Copied 4. What does it mean that the two strands of DNA are...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
1. Describe the structure of the DNA molecule and how this structure allows for the storage...
1. Describe the structure of the DNA molecule and how this structure allows for the storage of information, the replication of DNA, and protein synthesis. • What is the double helix? What are nucleotides, polynucleotide and base pairs? Use these terms to explain the structure of DNA. 2. List the similarities and differences between the various nucleic acid molecules. • What is semi-conservative replication of DNA? How does DNA get replicated?
Use the DNA sequence below and the genetic code in your text to answer the following...
Use the DNA sequence below and the genetic code in your text to answer the following questions. Template DNA 3ʹ T A A G C G A T A C G A G A 5ʹ Non-template DNA 5ʹ A T T C G C T A T G C T C T 3ʹ What is the RNA sequence that would be transcribed from the sequence above? Include the 3ʹ and 5ʹ ends. (0.5) b) What is the amino acid sequence...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Most questions answered within 3 hours.
-
(63
#14)
which of the following statments best describes how chamging
the concentration of the substances...
asked 2 hours ago -
In the following reaction, which element is undergoing
oxidation: Na2SO3 + N2O --> N2 + Na2SO4...
asked 2 hours ago -
Which of the following pairs of ions have the same electron
configuration?
I: Br− and Se2−...
asked 5 hours ago -
The Foremost Composite Materials Company is planning a two-day
sales conference for October 19-20. The conference...
asked 5 hours ago -
3) Illustrate the observed pattern of relatedness of organisms
versus adaptations to specific conditions. This means...
asked 6 hours ago -
In winter a lake has a 0.35 m thick ice layer over 1.10 m of
water....
asked 7 hours ago -
Assuming the following has been encrypted with a Vigenere cipher
below, use the method(s) and assumptions...
asked 7 hours ago -
How would I use switch statements to write a program that will
take an input of...
asked 7 hours ago -
Imagine a reaction in which methane gas combusts at a constant
pressure of 1 atm and...
asked 7 hours ago -
Two parallel wires (each 12 m in length) are separated by a
distance of 0.065 m...
asked 7 hours ago -
Suppose there were three masses at the corner of uniform
equilateral triangle. The masses are m1...
asked 7 hours ago -
Situation: A building that is 618 m above the ground floor. How
many times would a...
asked 7 hours ago