Homework Answers
5'UAGC3' is the sequence of rna in this diagram.
Double ringed are purines and single ringed are pyrimidines.this is simple funda you must remember
What is the strand of RNA that will be produced during transcription from this particular sequence...
What is the strand of RNA that will be produced during
transcription from this particular sequence of DNA
TGAGCCAAACCA?
Question 13 2 pts What is the strand of RNA that will be produced during transcription from this partial sequence of DNA: TGAGCCAAACCA? ACUCGGUUUGGU O ACUCGGTUTGGT O ACUCGGUUUCGU O ACTCGGTTTGGT
The schematic illustrates steps in RNA processing. The DNA strand is shown in red and yellow,...
The schematic illustrates steps in RNA processing. The DNA
strand is shown in red and yellow, and the RNA strand is shown in
green and blue. The steps in RNA processing are labeled 1-3, and
the components of the RNA transcript are labeled A-C.
Steps in RNA processing are indicated below in alphabetical
order, select the step number to put these processes in
chronological order. If the indicated step does not occur, select
'This process does not happen'.
removal of...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
OnuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGA...
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think...
Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think carefully about this answer! The question in my presentation had a mistake. DNA poll replaces the RNA primer at the 5' end of the new strand with DNA. DNA poll replaces the RNA primer at the 3' end of the new strand with DNA. None of the above Question 4 1 pts Telomerase works by Elongating the 5' to 3' newly replicated DNA strand...
What is the strand of RNA that will be produced during
transcription from this particular sequence of DNA
TGAGCCAAACCA?
Question 13 2 pts What is the strand of RNA that will be produced during transcription from this partial sequence of DNA: TGAGCCAAACCA? ACUCGGUUUGGU O ACUCGGTUTGGT O ACUCGGUUUCGU O ACTCGGTTTGGT
The schematic illustrates steps in RNA processing. The DNA
strand is shown in red and yellow, and the RNA strand is shown in
green and blue. The steps in RNA processing are labeled 1-3, and
the components of the RNA transcript are labeled A-C.
Steps in RNA processing are indicated below in alphabetical
order, select the step number to put these processes in
chronological order. If the indicated step does not occur, select
'This process does not happen'.
removal of...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
onuA sran A T TA CGATCTG CA CAAGACTT C Transcription mRNA strand Amino Acids ORNA Strand C GTACGAATTGCCAATTA CT Transcription mRNA strand: Amino Acids TA C G G A A T C GATG CGCGCACT ONA Strand RNA strand Translation 59. ad TA CCCATGGGGAAATATC ONA Strand mRNA strand Amino Acds randG CGCTA CA A TTGGATCG Translation Amino Acids ONA Strand GACUAGCUGGGGGUAUUACUUUUA G Transcription Translation DNA Strand ACCGCTCCGCCGTCGACAATACCACT ranscription mRNA strand Transcription A CCACCCCCGUAUGGCUGGGAAUAUC Anticodor
onuA sran A T TA CGATCTG CA...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
Question 2 1 pts What happens at the telomere once the RNA primer is removed? Think carefully about this answer! The question in my presentation had a mistake. DNA poll replaces the RNA primer at the 5' end of the new strand with DNA. DNA poll replaces the RNA primer at the 3' end of the new strand with DNA. None of the above Question 4 1 pts Telomerase works by Elongating the 5' to 3' newly replicated DNA strand...
Most questions answered within 3 hours.
-
Angel Corporation has $10,000,000 of
8.0% 25 year bonds dated May 1, 2018 with interest payable...
asked 9 minutes ago -
7.
________ involves individuals trading goods they already have or
providing services in exchange for something...
asked 13 minutes ago -
Share your research problem. What databases did you search as
you gathered evidence to support your...
asked 13 minutes ago -
what process occurs to form microspores and megaspores in flowering
plants?
asked 21 minutes ago -
C++
I need to use the function getData to put in all my data using
arrays....
asked 20 minutes ago -
A block is hung by a string from the inside roof of a van. When
the...
asked 27 minutes ago -
Do you think companies should not go for long term debt in their
capital structure to...
asked 36 minutes ago -
I create an address book where the user enters the name, phone
and email in the...
asked 42 minutes ago -
The production capacity for acrylonitrile
(C3H3N) in the United States exceeds 2
million pounds per year....
asked 49 minutes ago -
explain and comment out your answer
43. How many address lines are required to address a...
asked 56 minutes ago -
A sample of 45 observations is selected from a normal
population. The sample mean is 49,...
asked 1 hour ago -
A construction company is planning to bid on a building
contract. The bid costs the company...
asked 1 hour ago