In an experiment with agarose gel eletrophoresis, the DNA samples are loaded in the wells within...
In an experiment with agarose gel eletrophoresis, the DNA samples are loaded in the wells within the gel and the electric current is turned on. When observing the samples, you notice that the DNA fragments are moving in the opposite (wrong) direction. What possible error could have caused this to occur?
Homework Answers
Solution
- Electrophoresis is the technique of separation of DNA fragments according to there size and charges across electric field.
- DNA molecule has net negative charges so they are always moves towards positive electrode.
- If we change the polarity of electrode, positive electrode at loading site then DNA fragments not moving properly in there desired direction.so they choose direction towards positive electrode.
- So this is the cause that positive electrode is present at the site of well of DNA loading site.so fragments are moves in wrong direction.
Add Answer to:
In an experiment with agarose gel eletrophoresis, the DNA
samples are loaded in the wells within...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
EXERCISE 17.2: Sketch an agarose gel for use in separating DNA. Make sure you label: (a) The location of the wells (b) T...
EXERCISE 17.2: Sketch an agarose gel for use in separating DNA. Make sure you label: (a) The location of the wells (b) The positive electrode (c) The negative electrode ( d) The direction of migration of the DNA in the gel
After PCR is performed the products are run out on an agarose gel. In the figure...
After PCR is performed the products are run out on an agarose
gel. In the figure below, grey bands represent the wells the PCR
product was loaded into. The white bands represent DNA fragments
produced by PCR. The target fragment amplified by the primers was
1,500 bp in size.
The ladder is a standard DNA ladder containing bands of various
sizes between 5,000 and 1,000 bp. The negative control contained
only molecular grade water*. The positive control contained DNA
known...
NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the...
NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. 1)Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. 2)An electric current is passed through the gel. 3) DNA fragments are treated with a dye. 4)A restriction endonuclease is added to the DNA. 5)Using micropipettes, the DNA samples...
What would happen to DNA if the gel tray within an electrophoresis chamber were placed incorrectly,...
What would happen to DNA if the gel tray within an electrophoresis chamber were placed incorrectly, with the wells closest to the positive electrode? Choose one: A. DNA would remain in the gel. B. DNA bands would appear smeared. C. DNA would be pulled through the gel in the wrong direction. D. DNA would not fluoresce under UV light.
Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
Refer to the picture included in question 7 for this question. Please explain how gel electrophoresis...
Refer to the picture included in question 7 for this question.
Please explain how gel electrophoresis separates the DNA fragments
that are produced by the Sanger technique. Include the following
elements within your explanation (not necessarily in order of how
you should place them in your answer):
electric current and charge
size of DNA molecules
DNA samples
gel
wells
and buffer solution.
I I III I
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in...
a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in length? b) In agarose gel electrophoresis, two parallel and oppositely charged electrodes are situated at opposite ends of the gel. The surrounding solution is a “buffer”, an aqueous salt solution maintained at constant pH. The gel is made in the same buffer, with a small concentration of agarose. Because the concentration of agarose is small , everything between the electrodes can be considered to...
Can anyone show me step-by-step on how to do the agarose calculations? This week we will...
Can
anyone show me step-by-step on how to do the agarose calculations?
This week we will run the PCR reactions on an agarose gel and analyze the results. Safety notes: Ethidium bromide is a potent mutagen. Wear gloves when handling containers containing ethidium bromide, when handling gels that have been stained in ethidium bromide, and when working with the computer attached to the gel-doc system. Protocol I. Pouring agarose gels I. Using 10x TAE, prepare 50 ml of 3% (w/v)...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
After PCR is performed the products are run out on an agarose
gel. In the figure below, grey bands represent the wells the PCR
product was loaded into. The white bands represent DNA fragments
produced by PCR. The target fragment amplified by the primers was
1,500 bp in size.
The ladder is a standard DNA ladder containing bands of various
sizes between 5,000 and 1,000 bp. The negative control contained
only molecular grade water*. The positive control contained DNA
known...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
Refer to the picture included in question 7 for this question.
Please explain how gel electrophoresis separates the DNA fragments
that are produced by the Sanger technique. Include the following
elements within your explanation (not necessarily in order of how
you should place them in your answer):
electric current and charge
size of DNA molecules
DNA samples
gel
wells
and buffer solution.
I I III I
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Can
anyone show me step-by-step on how to do the agarose calculations?
This week we will run the PCR reactions on an agarose gel and analyze the results. Safety notes: Ethidium bromide is a potent mutagen. Wear gloves when handling containers containing ethidium bromide, when handling gels that have been stained in ethidium bromide, and when working with the computer attached to the gel-doc system. Protocol I. Pouring agarose gels I. Using 10x TAE, prepare 50 ml of 3% (w/v)...
Most questions answered within 3 hours.
-
There can be more than one correct answer.
Hypophysiotropic hormones:
A. released by the hypothalamus
B....
asked 21 seconds from now -
If you were conducting a study involving twins regarding
genetics and/or upbringing, which would you use?...
asked 19 minutes ago -
Part 1- Inventory: You own a toy company and
you are producing wooden rocking horses. Assume...
asked 28 minutes ago -
What is aromaticity?
Identify aromatic molecules, especially those containing O, N,
S and B
asked 31 minutes ago -
A rubber solid circular wheel of uniform density spins about it
axis at rate of 60...
asked 42 minutes ago -
DNA evidence from an early human skeleton in Britain, shows that
early inhabitants of were blue...
asked 34 minutes ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 42 minutes ago -
To practice Problem-Solving Strategy 19.1 Work in Ideal-gas
Processes.
A cylinder with initial volume V contains...
asked 51 minutes ago -
Depreciation for Partial Periods Bean Delivery Company purchased
a new delivery truck for $35,400 on April...
asked 55 minutes ago -
Q 5.23:
Jonathan has been doing calculations to determine a missing
component. So far he has...
asked 53 minutes ago -
Use indifference curve and the daily income-leisure choice model
to explain graphically the behavior of employees...
asked 1 hour ago -
Record the following transactions of Fashion Park in a
general journal. Fashion Park must charge 8...
asked 1 hour ago