Purification of Recombinant GFP from E. coli Was the GFP present in the supernatant or the...
Purification of Recombinant GFP from E. coli
Was the GFP present in the supernatant or the pellet of cell debris after the last centrifugation step of the E.Coli lysis experiment? Does this differential localization indicate that GFP is a globular or a fibrous/membrane type protein? Explain your reasoning.
Homework Answers
The recombinant EGFP expressed in Escherichia coli was purified using an economic aqueous two phase system. The purification of EGFP using two stages of alcohol + salt ATPSs ( aqueous two phase system) is efficient in terms of operation time, cost and process scalability.
Yes GFP wil be present in the supernatent during last centrifugation step of the E.coli lysis experiment.
Add Answer to:
Purification of Recombinant GFP from E. coli
Was the GFP present in the supernatant or the...
lab question 1. What is the basis of the different purification methods? 2. What are some...
lab question 1. What is the basis of the different purification methods? 2. What are some of the factors the might have interfered with your results? 3. How might you improve the process to increase the yield and purity? lab process E. coli BL21 (DE3) cells were transformed with the pET Topo-1521 vector containing a reading frame encoding the green fluorescent protein (GFP). Cells were cultured in M9ZB media at 37°C until the absorbance at 600 nm reached 0.7, at...
In-Class Activity #12, Protein Tratlicking Worksheet 1. You are interested in four different proteins in a...
In-Class Activity #12, Protein Tratlicking Worksheet 1. You are interested in four different proteins in a yeast cell: • protein 1 is a cytosolic protein protein 2 is a secreted protein • protein 3 is a nuclear protein protein 4 is a cell surface membrane protein with N-terminal end in extra-cellular space. a. You plan to study how the proteins are localized to their specific destination by creating the following mutations in the genes encoding proteins 1-4. Indicate how the...
recombinant DNA experiment Select the correct words from the drop-down menus for all 4 options (...
recombinant DNA experiment Select the correct words from the drop-down menus for all 4 options ( 1 mark ) Q1) After adding the cell lysis buffer and incubating, neutralisation enables the separation of plasmid DNA from chromosomal DNA based on their different sizes. On neutralisation, the single–stranded DNA species of both chromosomal and plasmid origin (previously separated or denatured by alkali treatment) tend to re-anneal or ‘renature’, but… (i) The Choose. (plasmid / bacterial chromosomal ) DNA can re-anneal faithfully...
Why are proteins heat denatured prior to analysis in SDS-PAGE? Select all answers that apply. Denaturation...
Why are proteins heat denatured prior to analysis in SDS-PAGE? Select all answers that apply. Denaturation of the protein is necessary so that proteins run proportionally to their size, based on the interaction of SDS with the unfolded protein. Heat is used to hydrolyze the peptide bonds of the protein. The heat step allows the proteins to unfold, enabling the protein chain to be coated with SDS molecules. Heat is used to hydrolyze disulfide bonds. QUESTION 2 1.5 points Saved...
From Hung et al., (2017) “Purification,characterization and biological effect of lectin from the marine sponge Stylissa...
From Hung et al., (2017) “Purification,characterization and biological effect of lectin from the marine sponge Stylissa flexibilis (Lévi, 1961)” Specimens were cut into small pieces, ground with a mixer machine and extracted (1:2, w/v) with 50 mM Tris–HCl, 150 mM NaCl buffer (pH 7.5) for 6 h at 4 °C. After filtration through a cheese cloth, the filtrate was centrifuged at 3500 × g for 30 min at 4 °C. To the supernatant, cold absolute ethanol (− 20 °C) was...
14. Recombinant MBP-, GST- or GFP- fusion proteins are expressed in bacteria not only for affinity...
14. Recombinant MBP-, GST- or GFP- fusion proteins are expressed in bacteria not only for affinity chromatography but also to ___________. A. overexpress the proteins in bacteria B. to reduce toxicity of the foreign proteins C. for proper folding and keeping the proteins soluble D. to trace the cytological location of the foreign proteins 15. You have constructed an insulin-GST fusion protein and expressed it in E. coli. You want to separate the recombinant...
5. Here is another promoter region in E. coli. (Also in a larger format in the...
5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...
For part 1 of this lab) I collected a soil sample from my campus Part 2)...
For part 1 of this lab) I collected a soil sample from my campus
Part 2) Tested bacteria initial viability Part 3) DNA extraction
Part 4) DNA quantification by Nanodrop Part 5) Sample sequencing
Part 6) PCR amplification Part 7) Gel electrophoresis Part 8) DNA
sequence data analysis (sent sample to another lab)
Directions for Part 3 DNA extraction are in the attached
image
QUESTIONS REGARDING PART 3 (DNA extraction)
1) What type of conclusions can be made from initially...
SIRJE GEL OBJECTIVE: Partial purification of a protein, isocitrate dehydrogenase (IDH), using DEAE ion exchange chromatography....
SIRJE GEL OBJECTIVE: Partial purification of a protein, isocitrate dehydrogenase (IDH), using DEAE ion exchange chromatography. IDH will be eluted from the column using increasing concentrations of KCI. IDH will be tracked using the IDH activity assay and the extent of purification will be analyzed using SDS PAGE Last week we assayed for the activity of the enzyme, isocitrate dehydrogenase, from E.coli strains carrying a plasmid that over-expresses the E. coli IDH gene. To purify proteins from cel extracts, biochemists...
1. You are studying phage transduction and trying to deliver a kanamycin resistance gene from one...
1. You are studying phage transduction and trying to deliver a kanamycin resistance gene from one strain of bacteria to another using phage. The kanR gene is FAR away from the lambda prophage in your bacterium. Choose which type of transduction should you use for your experiment and explain why. a. lambda phage, specialized transduction b. lambda phage, conjugation C. T4 phage, generalized transduction d. A different phage with mitomycin C induction 2. A pig is infected with two subtypes...
In-Class Activity #12, Protein Tratlicking Worksheet 1. You are interested in four different proteins in a yeast cell: • protein 1 is a cytosolic protein protein 2 is a secreted protein • protein 3 is a nuclear protein protein 4 is a cell surface membrane protein with N-terminal end in extra-cellular space. a. You plan to study how the proteins are localized to their specific destination by creating the following mutations in the genes encoding proteins 1-4. Indicate how the...
Why are proteins heat denatured prior to analysis in SDS-PAGE? Select all answers that apply. Denaturation of the protein is necessary so that proteins run proportionally to their size, based on the interaction of SDS with the unfolded protein. Heat is used to hydrolyze the peptide bonds of the protein. The heat step allows the proteins to unfold, enabling the protein chain to be coated with SDS molecules. Heat is used to hydrolyze disulfide bonds. QUESTION 2 1.5 points Saved...
5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...
For part 1 of this lab) I collected a soil sample from my campus
Part 2) Tested bacteria initial viability Part 3) DNA extraction
Part 4) DNA quantification by Nanodrop Part 5) Sample sequencing
Part 6) PCR amplification Part 7) Gel electrophoresis Part 8) DNA
sequence data analysis (sent sample to another lab)
Directions for Part 3 DNA extraction are in the attached
image
QUESTIONS REGARDING PART 3 (DNA extraction)
1) What type of conclusions can be made from initially...
SIRJE GEL OBJECTIVE: Partial purification of a protein, isocitrate dehydrogenase (IDH), using DEAE ion exchange chromatography. IDH will be eluted from the column using increasing concentrations of KCI. IDH will be tracked using the IDH activity assay and the extent of purification will be analyzed using SDS PAGE Last week we assayed for the activity of the enzyme, isocitrate dehydrogenase, from E.coli strains carrying a plasmid that over-expresses the E. coli IDH gene. To purify proteins from cel extracts, biochemists...
1. You are studying phage transduction and trying to deliver a kanamycin resistance gene from one strain of bacteria to another using phage. The kanR gene is FAR away from the lambda prophage in your bacterium. Choose which type of transduction should you use for your experiment and explain why. a. lambda phage, specialized transduction b. lambda phage, conjugation C. T4 phage, generalized transduction d. A different phage with mitomycin C induction 2. A pig is infected with two subtypes...
Most questions answered within 3 hours.
-
A 1,150 lumen light bulb is placed 37 cm in front of a mirrored
wall, whose...
asked 3 minutes ago -
Given that z is a standard normal random variable, compute the
following probabilities (to 4 decimals)....
asked 10 minutes ago -
You begin preparation of the calibration curve to measure
absorbance vs concentration of FeSCN2+. To do...
asked 27 minutes ago -
When you speak after breathing helium, in which the speed of
sound is much greater than...
asked 20 minutes ago -
3. Stock Valuation: You are the CEO of Under Armour, Inc. and
are thinking about how...
asked 24 minutes ago -
Choose a brand. Critique the brand in terms of its brand
positioning, brand identity and brand...
asked 27 minutes ago -
A vertical curve has grades G1 = 2.8% (downgrade) and
G2 = 2.2 (upgrade) Assume design...
asked 27 minutes ago -
(a) Derive planar density expressions for BCC
(110) plane in terms of the atomic radius R....
asked 22 minutes ago -
I have this problem now and I am not sure what we are exactly
supposed to...
asked 28 minutes ago -
Use the following set of observed frequencies to test the
independence of the two variables. Variable...
asked 51 minutes ago -
Two kg of ice at -15 °C are placed in a 2 kg bath of water...
asked 51 minutes ago -
Describe the following with suitable
examples.
1- Security Policy Heterogeneity
2-Security Model Heterogeneity
3-Security Mechanism Heterogeneity...
asked 52 minutes ago