2. Classify the following mutations in the coding strand of DNA above. Would the mutation have...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
4. Using the MK-Test, evaluate whether positive selection has driven the evolutionary divergence between Chimpanzees and Humans, Please show your work.. Second letter U C A UUU Phe UCU UAU UGU UCC Tyr UUA T UAC UAA Stop UGA UAG Stop UGG UGC Cys UCA Ser UUG FLeu UCG Trp G CUUT CUC CUA CCU CCC CCA. CCG CAU CAC His CAA CAG Gln CGU CGC Leu Pro Arg CGA CGG CUG G AUU 1 AUC lle A AUA ACU...
5 pts Question 33 The following prokaryotic DNA (same as above) is transcribed into RNA and the MRNA transcript is translated into protein. 31 21 11 1 ATGGGTTACT ATGAGGAGTT GACACACAAG AGGAGGTAGC 71 61 51 41 AGTATGGGTA TAATCTAATG CGTAATTGAG GAGGTAGTTG 101 111 91 81 ACGTATGCAT AGATAACGTA CGGGGGGGAA ACCCCCCCTT 141 131 121 TTTTTTTTTC GAGCAATAAA AGGGTTACAG Useful sequences: -35: 5' TTGACAT 3', -10: 5' TATAAT 3 (Pribnow box), Shine Dalgarno sequence: 5' AGGAGGU 3 THE GENETIC CODE THE GENETIC CODE SECOND LETTER A...