Please explain why,,
for the second prob, why is it not missense mutation..
Please explain why,, for the second prob, why is it not missense mutation.. 20. The following...
E. TAGGTGAAAGAAATCAGTTA UT EID: 4-38. The human RefSeg of the entire first exon of a gene involved in Brugada syndrome (a cardac disorder characterized by an abnormal electrocardiogram and an increased risk of sudden heart failure) is shown. The first exon includes the start codon. The genomic DNA of four people (1-4) was subjectesd to sequencing. The following sequences represent all those obtained from each person Nucledtides different from the RefSeq are underlined. RefSeq 5 CA ACG CTT AGG ATG...
Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79...
Assume that the The DNA changes provided above represent the sequences in the TEMPLATE STRAND. Determine what effect would mutation 3 have on the protein. For location of mutation- either "Present in mature RNA"or "Absent in mature RNA" For Amino Acids- three letters in upper case, if no amino acids are formed, write "NA", if stop codon is coded write "STOP" For type of change-write "missense", "nonsense", "silent", "neutral" or "NA" Location of mutation Amino acid for Amino acid Type...
D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...
please answer all 6 questions Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
Please note that Questions 15 to 17 are connected questions. Question 15: The following shows a partial DNA sequence from the wild-type (normal) allele for the human leukemia-linked apoptotic gene. 5' ATGCGATTAATCGGTAAA 3' (non-template strand) 3' TACGCTAATTAGCCATTT 5' (template strand) Please answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence? The mRNA sequence is 5' 3'. (2 marks) 5' AUG CGA UUA AUC GGU AAA 3' ? Please enter...
1. The following is a sequence of RNA. Do you expect it to adopt any kind of structure, and, if so, show what the structure would be? 5'-AUACUGCCCCCGGGGGAUGCCCGUAAACCGGGGUUACCCGGUUUAAACGGCCCCCCGGGGGCAGGCG-3'. 2. A dipoid yeast was ABD on one chromosome and abd on the other. The yeast cell underwent meiosis and the four genomes in the resulting tetrad were analyzed and determined to be: ABD, ABD, ABD and abd. a. For the moment, focus on the outcome regarding the number of B versus...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
please answer all 5! thank you! Question 1 1 pts Which of these individuals would be considered a 'mutant'? A person with an XO sex chromosome genotype The recessive allele for a straight hairline in humans A population of sunflowers which produce unique, red/orange petals, native to the southeastern tip of Kansas A turtle carrying an allele enabling it to wield a pair of daggers, present in only 0.0001% of the turtle population. Allele is expressed in dominant form prior...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...