Homework Answers
56) RNA polymerase
Explanation: RNA polymerase is an enzyme used to synthesise RNA from a DNA template.
57). Methionine, start
Explanation: In eukaryotes the first amino acid in a growing polypeptide chain is always methionine because the only codon for this amino acid is also the start codon which is AUG
58). Intron
Explanation: the coding sequences are called exons. The exons are interrupted by introns. The introns are not not appear in the processed RNA
Add Answer to:
Styles and 56. Paragraph Which of the following is not involved in the elongation step of...
Paragraph Lipod 64. Styles Which of the following is a ribonucleoprotein? A. Signal Recognition Particle B....
Paragraph Lipod 64. Styles Which of the following is a ribonucleoprotein? A. Signal Recognition Particle B. ribosome C. telomerase D. SnRNP E. all of the above 65._ What is the term for the base pair position in the diagram below? A. ambiguous B. jiggle C. redundant D. triplet E. wobble mini TRNA mRNA 5- 12 Name this position 1711 words Clipboard Font Paragraph amino acid binding site intrastrand hydrogen bonds "charged" tRNA binds to binds to 50S charging enzyme ribosomal...
Match the following choices to the questions below. UUU catalyzes translocation of the ribosome involved in...
Match the following choices to the questions below. UUU catalyzes translocation of the ribosome involved in transcription associated with the binding of mRNA in the ribosome binds to Shine-Dalgarno sequence involved in replication contains information in the form of anticodons catalyzes the formation of amino acid-AMP AUG UAG binds to pribnow box catalyzes formation of peptide bonds catalyzes disassembly of the translation complex associated with the binding of tRNA in the ribosome catalyzes disassembly of the transcription complex start codon...
B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter...
B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter represents a different mutation. Indicate which mutation would: (Use each letter only once.) trigger non-sense mediated decay increase transcript stability result in aberrant splicing reduce mRNA expression levels alter ADAR RNA editing promoter D — transcribed region intron A intron E exon- transcription factor binding sites exon spliced mRNA T 5'UTR CDS 3'UTR start codon stop codon C. (8pts) UAU encodes the amino acid...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
QUIZ 13 PROTEIN SYNTHESIS 1. The process where mRNA moves so that ribosomes can read each...
QUIZ 13 PROTEIN SYNTHESIS 1. The process where mRNA moves so that ribosomes can read each successive codon is referred to as A. Translation B. Transposition C. Translocation D. Transamination E. Transduction 2. The 2 amino acids have only a single codon. 1. Tryptophan 2. Methionine 3. N-formylphenylalanine 4. N-formylmethionine 5. Threonine A. 1 & 2 B. 1&3 c. 1 & 5 D. 2 & 3 E. 4 & 5 3. Peptide bonds linking the amino acids in protein synthesis...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a....
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...
Paragraph Lipod 64. Styles Which of the following is a ribonucleoprotein? A. Signal Recognition Particle B. ribosome C. telomerase D. SnRNP E. all of the above 65._ What is the term for the base pair position in the diagram below? A. ambiguous B. jiggle C. redundant D. triplet E. wobble mini TRNA mRNA 5- 12 Name this position 1711 words Clipboard Font Paragraph amino acid binding site intrastrand hydrogen bonds "charged" tRNA binds to binds to 50S charging enzyme ribosomal...
Match the following choices to the questions below. UUU catalyzes translocation of the ribosome involved in transcription associated with the binding of mRNA in the ribosome binds to Shine-Dalgarno sequence involved in replication contains information in the form of anticodons catalyzes the formation of amino acid-AMP AUG UAG binds to pribnow box catalyzes formation of peptide bonds catalyzes disassembly of the translation complex associated with the binding of tRNA in the ribosome catalyzes disassembly of the transcription complex start codon...
B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter represents a different mutation. Indicate which mutation would: (Use each letter only once.) trigger non-sense mediated decay increase transcript stability result in aberrant splicing reduce mRNA expression levels alter ADAR RNA editing promoter D — transcribed region intron A intron E exon- transcription factor binding sites exon spliced mRNA T 5'UTR CDS 3'UTR start codon stop codon C. (8pts) UAU encodes the amino acid...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...
QUIZ 13 PROTEIN SYNTHESIS 1. The process where mRNA moves so that ribosomes can read each successive codon is referred to as A. Translation B. Transposition C. Translocation D. Transamination E. Transduction 2. The 2 amino acids have only a single codon. 1. Tryptophan 2. Methionine 3. N-formylphenylalanine 4. N-formylmethionine 5. Threonine A. 1 & 2 B. 1&3 c. 1 & 5 D. 2 & 3 E. 4 & 5 3. Peptide bonds linking the amino acids in protein synthesis...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...
Most questions answered within 3 hours.
-
A 0.035 mol sample of a weak acid, HA, is dissolved in 437 mL of
water...
asked 58 seconds ago -
a sample of Ar gas has a volume of 6.30 L with an unknown
pressure. the...
asked 1 minute ago -
The
serum cholesterol levels of a population of kids follow a normal
distribution with mean 155...
asked 21 minutes ago -
han discusses the racist practice of badlands, a bar
in the Castro
district of San Francisco,...
asked 33 minutes ago -
A sample of final exam scores is normally distributed with a
mean equal to 25 and...
asked 36 minutes ago -
An investor shorts 100 shares of a stock when the share price is
$50 and closes...
asked 40 minutes ago -
LLOP corporation just paid 4$ dividend per share, you expect the
dividend to grow 8% for...
asked 50 minutes ago -
if we subtract 1000 from 0001 is there overflow? (binary)
asked 58 minutes ago -
Hello, I need help with the function below, The language I am
using is Ocaml
open...
asked 59 minutes ago -
Explain how the presence of glucose represses the gal structural
genes?
asked 1 hour ago -
For the reaction CaI2+2AgNO3⟶2AgI+Ca(NO3)2 how many grams of
silver iodide, AgI, are produced from 56.5 g...
asked 1 hour ago -
Write an equation for hydrolysis via acid catalysis.
Using ethyl acetate, ethyl benzoate, ethyl formate or...
asked 1 hour ago