Question

Describe the regulation associated with attenuation. Describe how specifically this regulates the amount of various amino...

Describe the regulation associated with attenuation. Describe how specifically this regulates the amount of various amino acids within a bacteria cell.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The process of attenuation is a regulatory characteristic that can be found in Bacteria and Archaebacteria that lead to premature termination or block of the transcription process. The attenuators are the 5'-cis-acting regulatory areas that fold into one of two substitutes of the RNA structures that conclude the accomplishment of transcription.

In bacteria cells, attenuation controls the trp operon. It involves the existence of a stop signal that signifies premature termination. Like the regulation of trp by the trp repressor, attenuation is a system for reducing the trp operon expression when the levels of tryptophan are elevated. Though, to a certain extent than blocking the initiation or beginning of transcription, attenuation stops the transcription end or completion.

Add a comment
Know the answer?
Add Answer to:
Describe the regulation associated with attenuation. Describe how specifically this regulates the amount of various amino...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • * 2.1 Describe different ways to classify amino acids and predict whether change in amino acid...

    * 2.1 Describe different ways to classify amino acids and predict whether change in amino acid is likely to disrupt protein structure * 2.2 Compare and contrast the different levels of protein structure and how they relate to one another * 2.3 Describe the biochemical information that determines the final three-dimensional structure and explain what powers the formation of this structure * 2.4 Explain how structure determines function in general and using hemoglobin and myoglobin as specific examples.   * 2.5...

  • 1. Describe in detail how both positive and negative regulation control expression of the lac operon...

    1. Describe in detail how both positive and negative regulation control expression of the lac operon in bacteria. In doing this, also convey understanding of how and why expression of this operon is controlled two ways (positive and negative). Also answer, what are the energetic benefits to the cell of operon regulation? 2. What is horizontal gene transfer? Describe in detail the three mechanisms of horizontal gene transfer. What are the evolutionary advantages and costs of horizontal gene transfer. I...

  • Describe at least one federal regulation for healthcare. How does this regulation influence delivery, cost, and...

    Describe at least one federal regulation for healthcare. How does this regulation influence delivery, cost, and access to healthcare (e.g., CMS, OSHA, and EPA)? Has there been any change to the regulation within the past 5 years? Explain.

  • Describe how inorganic nitrogen is assimilated into glutamate and the other 19 amino acids used for...

    Describe how inorganic nitrogen is assimilated into glutamate and the other 19 amino acids used for protein synthesis. What are the products of amino acid oxidation and how do humans dispose of their nitrogenous waste?

  • Describe the chemical properties of amino acids and discuss how they can affect the final structu...

    Describe the chemical properties of amino acids and discuss how they can affect the final structure of a folded protein. In your answer, give examples of amino acid substitutions that could cause changes to a protein’s structure and function

  • Explain how a superantigen toxin non-specifically stimulates T cells. Why does non-specific stimulation of T cells...

    Explain how a superantigen toxin non-specifically stimulates T cells. Why does non-specific stimulation of T cells make a person sick? Explain the molecular mechanisms by which quorum sensing regulates TSST-1 expression. How do  superantigens promote immune evasion? Describe impacts on B cells and T cells Why is toxic shock syndrome associated with high absorbency tampons and menstruation?

  • 3) Antibodies can be membrane-bound or secreted, depending on whether a stretch of additional amino acids...

    3) Antibodies can be membrane-bound or secreted, depending on whether a stretch of additional amino acids are present or not. What process do you think determines if these amino acids are present? postranslational covalent attachment of a membrane spanning domain to the antibody alternative RNA splicing phosphorylation polyadenylation ubiquitin addition 10) How does the Cas9 system target where it produces a double-strand break in the DNA? The Cas9 protein binds to a recombinase, allowing it to disable the gene of...

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • 1. Identify the basic shapes of bacteria and formation under the microscope. 2. Describe how bacteria...

    1. Identify the basic shapes of bacteria and formation under the microscope. 2. Describe how bacteria are identified and named under the microscope. 3. Distinguish between Gram positive and Gram negative bacteria. 4. Explain the ways bacteria reproduce themselves. 5. Describe what makes prokaryotic cells different from eukaryotic cells. 6. Identify the internal and external structure of bacteria. 7. Define plasmids and how bacteria use them 8. Describe the 2 categories of bacteria found in the Moneran kingdom. 9. Bacterial...

  • Viruses- Bacteriology -Describe the characteristics of viruses. -Explain receptors for bacterial viruses (bacteriophage). -How do bacteria...

    Viruses- Bacteriology -Describe the characteristics of viruses. -Explain receptors for bacterial viruses (bacteriophage). -How do bacteria prevent the invasion of foreign nucleic acids? -What is reverse transcriptase and which viruses use it? -What type of nucleic acids is in many important human disease-causing viruses? -List the possible consequences of viral infection of an animal cell? -Differentiate between animal and bacterial viruses. -Describe both lytic and lysogenic cycles. -Explain the potential advantages of lysogeny versus lysis for a temperate virus

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT