Question

e) (2 points) Your supervisor suggests you produce a cDNA library for the yeast in order to produce the genes in bacteria and perform enzymatic analysis. You do so and are able to isolate a vector for your gene (you call this gene Yuml). You send your vector in for sequencing and are given the sequence of your gene and surrounding regions (shown below). 5' TCCGGCGGAATTCCAAGGCCT 3' AGGCCGCCTTAAGGTTCCGGA Yum1 CGTCGACTCCGGC GCAGCTGAGGCCG 3' 5' You want to PRC amplify your specific gene in order to clone it into an expression vector. Which set of primers should you choose to amplify the entire Yuml coding sequence? Set 1: 5' AGGCCG 3 Set 2: 5' TCCGGC 3 Set 3: 5' TCCGGC 3 5' GCCGGA 3' 5 'ACCGGG 3' 5 ' GCCGGA 3' 1) (3 Points) you successfully amplify the Yuml coding region and surrounding regions as shown above) and plan to clone the PCR fragments into an expression vector (vector2), the vector and its available cloning sites are shown below. Stul: 5'-AGG CCT-3' 3'-TCC GGA-5' Sall cuts: 5'-GTCGAC-3' 3'-CAGCTG-5' ECORI: 5'-GAATTC-3' 3'-CTTAAG-5' Promoter > Stul Sall K EcoRI Vector 2 There are two possible ways to insert the amplified gene into vector 2. What are they? Option 1: Cut plasmid with _; cut gene loci with Option 2: Cut plasmid with ___;cut gene loci with Is one of these two options better? If so why? _&__

Answer 1

1. Primer set 3 should be used for the PCR
This is due to the fact that both these primers are anti-parallel to each other and flank the coding sequence.
The forward primer sequence is similar to the top strand at the 5'-end.
The reverse primer sequence is similar to the bottom strand at the 5'-end.
See the image

2. We can use two sets of enzymes to cut and clone the fragment.
i. Cut the plasmid with StuI and SalI.
Cut the gene locus with StuI and SalI.

ii. Cut the plasmid with EcoRI and SalI.
Cut the gene locus with EcoRI and SalI.

The second option is better.
This is due to the fact that StuI produces blunt ends which are difficult to ligate.
On the other hand, EcoRI and Sal I produce overhangs which exhibit a greater ligation efficiency.

See the image

Forward primer Sall Yum1 CGTCGACTCCGGC 3' IGCAGCTGAGGCCG 5' 5' TCCGGCGGAATTCCAAGGCCT 3' AGGCCGCCTTAAGGT TCCGGA Eco RI Stul Reverse primer

Please provide a POSITIVE RATING. Thank you