The sequence of gel is read from bottom to top in direction 5' to 3'.
So, this sequence will be,
5' TGCTAGC 3'
This is coding strand.
But template strand is in direction 3' to 5' and complementary to coding strand.
3' ACGATCG 5'
So, last option is correct.
Please rate high.
Question 13 4 pts A fragment of DNA is cloned into a plasmid with a sequencing...
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG
Which of the following statements is correct concerning operon gene control? Positive control requires an activator protein to stimulate transcription of the structural genes within an operon. In negative control, a repressor protein inhibits or turns off transcription of the structural genes within the operon. An inducible operon normally is not transcribed. It requires an inducer molecule to stimulate transcription either by inactivating a repressor protein in a negative inducible operon or by stimulating the activator protein in a positive...
Attempt 3 - Question 13 of 22 > ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5-
Fall 2017 CHE 380: Introduction to Biotechnology Exam3 (I hr 20 min) Question 3 (28 polnts) and label the reaction was conducted on the b. Read the sequence A DNA sequencing was template strand in a thin capillary gel tube containing primers, DNA polymerase, deox yribuneeleotides and|メイenmcaT luorescently tagged dideoxyribunecleotides and a e. The smallest fragment is computer was used to record the fluorescent peaks during fluorescently tagged with (A)ddATP (B) ddGTP (C) ddCTP (D) ddTTP was used to reoribunecleotidesnanTCAATGaTa...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
1. To conduct the above Sanger sequencing reaction, you add to an eppendorf tube: the DNA you want to sequence, DNA polymerase, dATP, dGTP, dCTP, dTTP, ddATP-green, ddGTP-black, ddCTP-blue, ddTTP-red and what else?
3. (3 points) What is the sequence of the double-stranded DNA that is determined from the following " page. You must label the ends of the double-stranded molecule. old school" Sanger sequencing gel? The top of the gel is towards the top of the ddATP ddCTP ddGTP ddTTP
QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...