Question


please answers fast and in detail. thank youuuuu

Question #4 (10 points)-Mass spectroscopy Amino Acid Molecular Weight 89 174 133 146 75 146 115 137, 194 Alanine Arginine Asp

it is biochemistry question not the chemistry. By mistake I put chemistry. please do it and send me answer as soon as possible, thank youuuu.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Solution

The pentspeptide sequence is

N-Glutamate-Aspartate-Lysine-Serine-Arginine-C

because all 5 amino acid matching the peak value to its molecular weight.

Glutamate showing mol.wt.of 146 but actual mol.wt. is 147. So if we want to identify N terminus of pentapeptide we have add mol.wt. of 1 Hydrogen into glutamate. Hence glutamate present at N terminus position.

according to stablization of positive and negative charged amino acids if negatively charged amino acid is present at first position then positively charged amino acid will be far away by 3/4 amino acid apart from negatively charged amino acid.

so arginine present at C terminus of pentapeptide.

aspartate can present at 2nd position and lysine and serin will at 3 and 4th position respectively.

Add a comment
Know the answer?
Add Answer to:
please answers fast and in detail. thank youuuuu it is biochemistry question not the chemistry. By...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question #4 (10 points) - Mass spectroscopy Amino Acid Molecular Weight 89 174 133 146 137,...

    Question #4 (10 points) - Mass spectroscopy Amino Acid Molecular Weight 89 174 133 146 137, 194 Alanine Arginine Aspartic acid Glutamic acid Glycine Lysine Proline Serine Tyrosine Valine 105 384 340 Hidal 146 115 105 181 117 146 Mass/charge (here the charge is -1, so it's just mass) Above is shown a mass spectroscopy for a peptide 5 amino acids long derived from a soluble protein. This 5 amino acid peptide represents a hydrophilic surface part of the protein...

  • Protein Structure A protein contains a string of amino acids (usually more than 50) that has...

    Protein Structure A protein contains a string of amino acids (usually more than 50) that has a biological function. 15ecause proteins are so large, their structure has several levels, all of which are important for the proper functioning of the protein. Ultimately, the sequence of amino acids (ordering of polar and nonpolar amino acids) dictates the 3-dimensional shape of a protein and this dictates its primary function. Level 1: Primary (1") The amino acid sequence of a polypeptide Protein Backbone...

  • Question 5 Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has...

    Question 5 Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has the molecular formula: Asp, Glu, His, Phe, Val. Partial hydrolysis of the pentapeptide gives: Val Asp, Glu His, Phe Val, and Asp Glu. What is the amino acid sequence of the pentapeptide? 3. When the pentapeptide below is heated first with 2,4-dinitrofluorobenzene...

  • 1. Please provide correct solution. Thank you. Acid rain is a serious environmental problem. A sample...

    1. Please provide correct solution. Thank you. Acid rain is a serious environmental problem. A sample of rainwater collected in the Sierra Mountains had an H+ concentration of 0.1 mmol/L. The pH of this sample was 0 1 3 4 100 Rank the elements carbon (C), hydrogen (H), oxygen (O), and phosphorus (P) in decreasing order number of covalent bonds they usually form. C > P > N > O >H P > O > C > N > H...

  • (18 pts) Answer True or False for each of the following questions (a) An amino acid...

    (18 pts) Answer True or False for each of the following questions (a) An amino acid is in the zwitterionic form only if the pll is well below 7 (b) Salting out takes advantage of the fact that the solubility of proteins varies with concentration. (c) Proteins usually consists of amino acids of both L-isomers (d) Essentially all a-helices found in proteins are left-handed globular protein is thermodynamically the most stable structure. ( Isoclectric focusing can be used to separate...

  • circle answer or highlight only please thank you Question 20 1.79 pts The chemical makeup of...

    circle answer or highlight only please thank you Question 20 1.79 pts The chemical makeup of oils is Oesters of glycerol with three predominantly unsaturated fatty acids. esters of glycerol with three identical saturated fatty acids. simple esters of long chain alcohols and fatty acids. esters of glycerol with three identical unsaturated fatty acids. Oesters of glycerol with three predominantly saturated fatty acids. Question 21 1.79 pts Saturated triacylglycerols are usually because O liquids; they have relatively short fatty acid...

  • of alanine has a pk of 9.87. What is the 153, The amino group charge on...

    of alanine has a pk of 9.87. What is the 153, The amino group charge on that amino group at pH 7.0 145. Which amino acid serves as the first amino acid at the hN terminus of a newly synthesized protein? (B) methionine (A) alanine 9.80. The side chain of that amino acid includes (A) an amine group (C) a carboxylic acid group. (D) an alcohol 154. A certain amino acid has a pl (or pH, isoelectric point) (D) threonine...

  • Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you...

    Please provide justifications for all answers so I understand. Extra detail is very helpful. Thank you so much. Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...

  • please help me type my introduction for my lab report. thank you!! INTRODUCTION In this section,...

    please help me type my introduction for my lab report. thank you!! INTRODUCTION In this section, you will introduce the experiment by explaining generally what you did and why you did it. This section usually starts with an examination of the literature through a library search to inform the reader about work already done on this topic. If you have never done a bibliographic database search for scientific journal articles, then you are not yet a biological sciences major (note:...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT