Question
pls answer all
Question 1: The following figures (Figure 1 and Figure 2) show the structure of DNA and of a chromosome. Label each part (A-J
0 0
Add a comment Improve this question Transcribed image text
Answer #1

a 5 GTA TGA TCC TAG GCC & Complimentary Sequence CAT ACT AGC ATC CGG (b) (Transcribed) sequence) 5 CITA CAU T GA ACU TCC, ACI6 5 ③ P GC Phosphate - Bond between certosine & Gronine is Three Hydnogen bonds. Bond between Adenine & The mine is Two Hydro

Add a comment
Know the answer?
Add Answer to:
pls answer all Question 1: The following figures (Figure 1 and Figure 2) show the structure...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...

    Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...

  • Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA:...

    Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA: GCG GCG TAC CCC AAA ATA GGG GCG CTC GCG ATT AAA CCG TTC CCC What is the untranscribed strand? What is the mRNA sequence that would be transcribed from the transcribed strand? What is the sequence of tRNA nucleotides that would match up with the mRNA? What is the amino acid sequence that would result from translation of the mRNA?

  • en the letters write your answer as one word. Do not include the word STOP for...

    en the letters write your answer as one word. Do not include the word STOP for the stop codon For Item D: Draw the correct structure for the peptide on Part C. You can write the polypeptide as a condensed structure or as a skeletal structure Given the following single stranded DNA (coding strand answer the following questions 5-AAT ATG TAC GAC AAC GCC TAG AGG 3 a) (Ipt) What is the complementary strand (template strand; 3'-5" direction) for the...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • 23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap...

    23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap of a properly modified mRNA B. transcription factors C. the anticodon of a properly formed aminoacyl tRNA D. the sequence of the coding strand E. all of the above 24. If the DNA code for a particular amino acid is 5'AGT3', then the anticodon on the tRNA would be A. 5'TCA3 B. 5'UCA3 C. 5'AGU3 D. 5'ACU3 E. 5'UCA3 25. What enzyme catalyzes the...

  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

  • 4. Given the following information: One strand of a section of DNA isolated from E. coli...

    4. Given the following information: One strand of a section of DNA isolated from E. coli reads                                     5’-GTAGCCTACCCATAGG-3’                                     3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • Can anyone explain these answers step by step. Especially I do not know how to start...

    Can anyone explain these answers step by step. Especially I do not know how to start question 1 or two!!! Thank you! Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...

  • The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...

    The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT