Could someone please check my answers?
1. A researcher uncovers a fossil in South America that looks quite similar to a species that currently lives in Africa but does not resemble other South American species. The climate and vegetation in the two locations are very different. What is the MOST likely explanation?
A. The fossil must have been transported across the ocean during storms.
B. The species are probably not closely related due to convergent evolution.
C. There was probably an aquatic common ancestor to both species that was capable of migrating from one location to the other and that preferred conditions in Africa, so it was more common there.
D. A common ancestor of the species was found in both places when the continents were closer together, and its descendants went extinct in South America.
(I think it's D)
2. You are interested in trying to work out whether adaptive radiation in mollusks occurred after the Cretaceous extinction. What sort of data would you need to collect?
A. You would need to work out the total number of species present in different locations at the present time.
B. You would need to examine the number of species present before the extinction event with the number present after the extinction event.
C. You would need to determine the number of species present before the extinction event and the number present today.
D. You would need to work out the number of species present immediately after the extinction only.
(I think it's B)
3. Which of the following gives the BEST example of data that you could use to determine whether a mutation in a developmental gene was responsible for speciation in a particular group of animals?
A. You could only use standard techniques to sequence the gene and see whether it differed in different species.
B. You could compare the sequence of the gene in different species and see the effects of different forms of the gene in genetically modified organisms.
C. You could use genetic engineering to turn the developmental gene on and off to determine what it does within the group of animals that interests you.
D. You could examine closely related groups of species to see whether they have the identical gene.
(I think it's D)
4. From a lifetime of observation, you know that birds have feathers. What is the MOST likely explanation for how feathers evolved?
A. Feathers evolved because of their value for flight.
B. Feathers evolved because it is not possible to fly without them, so wings would not have evolved it feathers had not developed first.
C. Feathers developed from a random mutation in a developmental gene, which allowed a full wing to form once it was turned on and fully expressed.
D. Feathers evolved because they helped to insulate birds and served other functions, then were later helpful in flying and became more specialized for that purpose.
(Umm I thiiink it's D..?)
5. Adaptive radiation often occurs after a mass extinction. If you were examining fossil beds and found evidence of the rapid appearance of new species in an apparent adaptive radiation event, could you conclude that a mass extinction had occurred?
A. yes because the presence of adaptive radiation means that there must have been newly vacated niches to fill
B. yes because the appearance of new species always means that adaptive radiation has occurred, and no further data is needed to answer that particular question
C. no because speciation and adaptive radiation can occur for other reasons, such as substantial environmental changes; you would need to examine earlier fossils to know more
D. no because there is not enough evidence to know whether speciation occurred
(I think it's C)
Thank you sooo much for your help in advance. I really appreciate it :D
All of the above answers seem correct.
1. D. A common ancestor of the species was found in both places when the continents were closer together, and its descendants went extinct in South America.
2. B. You would need to examine the number of species present before the extinction event with the number present after the extinction event. (to compare you need data of before and after extinction).
3. D. You could examine closely related groups of species to see whether they have the identical gene. but the option C. (You could use genetic engineering to turn the developmental gene on and off to determine what it does within the group of animals that interests you.) can give you a more accurate results.
4. D. Feathers evolved because they helped to insulate birds and served other functions, then were later helpful in flying and became more specialized for that purpose. (yes it is correct).
5. C. no because speciation and adaptive radiation can occur for other reasons, such as substantial environmental changes; you would need to examine earlier fossils to know more.
Could someone please check my answers? 1. A researcher uncovers a fossil in South America that...
Could someone check my answers, please? 1. Suppose that a species of fish has split into two populations in a lake: one on the eastern side and one on the western side. How could you determine whether the two populations constitute different species? A. Examine the populations for morphological, color, or other physical differences. B. Examine the populations for different genetic markers and allele frequencies. C. Attempt to breed members from the two populations in captivity. D. Introduce members from...
Permian extinction... Which of the following statements about the Permian extinction is FALSE? A. An estimated 95% of all marine species were lost during the event. B. Adaptive radiations of surviving groups occurred afterwards. C. An estimated 70% of all terrestrial vertebrate species were lost during the event. D. It occurred around 250 million years ago. E. It caused the extinction of the dinosaurs. Which of the following statements about taxonomy is FALSE? A. Species that are in the same...
1. Population is not used in describing species. Population is a group of organisms of the same species populating a given area, a group of individuals of the same species that live in the same area and interbreed, producing fertile offspring. Interbreeding, sexual reproduction, natural selection and color are used in describing species. Individuals in an interbreeding population share in a common gene pool. My question is can you tell me how interbreeding, sexual reproduction, natural selection and color are...
Question 1 (1 point) In a species of flowering plant, petal color is determined by one gene with two alleles, R and W. Individuals homozygous for allele R have red petals, and those homozygous for allele Whave white petals. Ris dominant to W. You cross a pure- breeding red flowered plant with a pure-breeding white flowered plant to create an F1 generation. You then cross two individuals from the F1 generation to create an F2 generation. What proportion of the...
please help me with these questions. i cant post anymore and im studying for my exam. thank you in advance A flock of birds which are blown of course and end up on an unpopulated island could be an example of: Vicariant Speciation a Founder Event A Bottleneck Natural Selection Which of the following is NOT one of the five theories of Darwinism (Mayr)? Survival of the fittest Gradualism Common descent Perpetual Change Multiplication of species Which of the following...
12. The ideal free distribution (IFD) involves individuals that have ideal information and are free to move about, while the ideal despotic distribution (IDD) involves individuals who have ideal information but are sometimes excluded from locations by better competitors. The IDD is to the IFD as a. Territoriality is to clumped dispersion b. Conditional strategies are to alternative strategies C. Migration is to reproductive value d. Anisogamy is to sex allocation 13. You are at home over spring break and...
QUESTION 1 The “Cambrian Explosion” describes the relatively sudden appearance of __________ in the fossil record in the Cambrian. Metazoans Eukaryotes Algae Cephalopods Chocolate 0.5 points QUESTION 2 Poriferans lack: Extracellular matrix Organs Choanocytes Nuclei 0.5 points QUESTION 3 Which of the following has no terrestrial species? Brachiopoda Nematoda Mollusca Arthropoda 0.5 points QUESTION 4 The metazoan phylum with the greatest diversity (i.e., number of species) today is: Arthropoda. Annelida. Cnidaria. Mollusca. 0.5 points QUESTION 5...
For this assignment, we will consider a protein expressed in the liver of an African cheetah (Acinonyx jubatus). Biochemists determined that this protein is involved in the production of glycogen. In a stunning announcement, a snowboarder in Antarctica claims to have found a new species of cheetah that is able to survive freezing temperatures and a long, dark winter. The snowboarder described a slow, fat, white-furred cheetah that may be related to the African cheetah. Scientists isolated a fragment of...
1)Angiosperm plants DO NOT have a demonstrated coevolutionary interaction, diffuse or strong, with which group? Select one: a. Social hymenopterans b. Lepidopterans c. Non-hominoid primates d. Herbivorous Permian synapsids 2)If strictly herbivorous animals feeding on C3 plants are switched entirely to C4 plants, what would we see in their tissues? Select one: a. Enrichment of 13C b. Depletion of 13C 3)When plant matter is buried, which carbon isotope will be buried in a greater proportion than it exists in the...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...