True or false: A piece of DNA cut with a restriction enzyme such as Bam H1...
True or false: A piece of DNA cut with a restriction enzyme such as Bam H1 is unlikely to be successfully ligated into a plasmid that has been cut with a different enzyme such as EcoR1.
Homework Answers
I believe the correct answer to be:
Option A) TRUE.
As both will cut at the different locations making two different sequence of sticky ends and hence can not be ligated unless the sticky end part is eleminated altogether.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
Add Answer to:
True or false: A piece of DNA cut with a restriction enzyme such
as Bam H1...
A restriction map lists the locations of DNA sequences that are cut by a particular restriction...
A restriction map lists the
locations of DNA sequences that are cut by a particular restriction
enzyme for a piece of DNA, such as a chromosome or a plasmid.
Restriction maps are important when generating a construct for
experimental use. Digesting the DNA sequence with the restriction
enzymes will result in fragmented DNA of predictable sizes, based
on the restriction map, that allow a researcher to analyze if his
or her construct was generated correctly when visualized using gel
electrophoresis....
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
1.) If we mix two restriction fragments cut with the same restriction enzyme in the presence of DNA ligase, ATP and appropriate buffer, we will obtain... A) protein B) carbohydrate C) recombinant DNA...
1.) If we mix two restriction fragments cut with the same restriction enzyme in the presence of DNA ligase, ATP and appropriate buffer, we will obtain... A) protein B) carbohydrate C) recombinant DNA or plasmid D) pAMP
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme...
Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
A restriction map lists the
locations of DNA sequences that are cut by a particular restriction
enzyme for a piece of DNA, such as a chromosome or a plasmid.
Restriction maps are important when generating a construct for
experimental use. Digesting the DNA sequence with the restriction
enzymes will result in fragmented DNA of predictable sizes, based
on the restriction map, that allow a researcher to analyze if his
or her construct was generated correctly when visualized using gel
electrophoresis....
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
Most questions answered within 3 hours.
-
A χ2-curve, looking at the relationship between age and hours
spent working at an office per...
asked 1 minute from now -
The pH of a sample of water from a river is 5.0. A
sample of effluent from...
asked 43 minutes ago -
At the beginning of the period, the Fabricating Department
budgeted direct labor of $136,500 and equipment...
asked 1 hour ago -
Please answer all
____ 28. Rent control is usually
justified on the grounds that it protects...
asked 1 hour ago -
PARTS A-D HAVE BEEN ANSWERED. WAS TOLD TO REPOST. ONLY ANSWER
PARTS E and F.
A...
asked 1 hour ago -
2) You are given the task of finding a representation for a
circle in a drawing...
asked 2 hours ago -
STUDY QUESTION: Does use of diet drug fen-phen
(fenfluramine-phentermine) cause valvular heart disease?
HINT: Valvular heart...
asked 2 hours ago -
1. An object weighing 40 N rests on a surface. The coefficient
of friction is 0.35....
asked 3 hours ago -
Investor company owns 35% of investee company voting stock and
accounts for the investment under the...
asked 4 hours ago -
The number of major faults on a randomly chosen 1 km stretch of
highway has a...
asked 5 hours ago -
Consider the competitive environment of Starbuck's, Progressive
Insurance, a manufacturing firm with low turnover, or a...
asked 5 hours ago -
3. Gains from trade
Consider two neighbouring island countries called Euphoria and
Contente. They each have...
asked 7 hours ago