If you wished to replace one gene with another in the chromosome, would linear double stranded...
If you wished to replace one gene with another in the chromosome, would linear double stranded DNA or covalently closed circular DNA be better to use and why?
Homework Answers
Answer:
Relaxed double helical segment is more advantageous to replace genes with another (in prokaryotes, ex plasmid DNA, is an extra chromosomal) because DNA is present in a closed-circular, double-stranded molecule. It has no net DNA bending on its axis. Eukaryotic chromosomal DNA is linear but not circular. Three different sources DNA that people usually used in constructing recombinant DNA: recombinant DNA is also known as “chimeric DNA” (gene replaced with another gene). Circular form of DNA has more affinity to undergo “gene cutting” when using restriction endonucleases (nicks can be produced at either end of the cos site of circular DNA to generate a covalently closed ends) finally can be easily ligated using “DNA ligases”
Add Answer to:
If you wished to replace one gene with another in the
chromosome, would linear double stranded...
This figure represents supercoiled, circular, double-stranded DNA: If this molecule of DNA originated as a linear...
This figure represents supercoiled, circular, double-stranded DNA: If this molecule of DNA originated as a linear molecule with a linking number (L) of 30, which was then circularized and unwound, the L for the unwound circular molecule would be O32 O 18 O 28 O 30 20
In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand...
In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand for one gene may be the nontemplate strand for another gene. true or false
All are the same diagrams Consider the following double-stranded region of a gene: Strand 17 5'-...
All are the same diagrams
Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2 3-TTAGCATACGCTTCGGGAATTGA - 5 The number of mRNA codons in the corresponding transcript is: A 1 3.4 OC5 E Cannot be determined Consider the double-stranded DNA sequence of a gene below: Strand 1: 5'-AATCGTATGCGAAGCCCTTAACT-3' Strand 2. 3'-TTAGCATACGCTTCGGGAATTGA-5 The number of amino acids in the corresponding peptide is: OOOOO du . w Consider the following double-stranded region of a gene below: Strand 17...
An investigator would be able to distinguish a solution containing single-stranded DNA from one containing double-stranded...
An investigator would be able to distinguish a solution containing single-stranded DNA from one containing double-stranded DNA by a. Cooling the solutions to 16°C and measuring the absorption of light at 260 nm. b. Measuring the absorption at 280 nm. c. Monitoring the change in absorption of light at 260 nm while elevating the temperature.
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
31.In humans, the gene for B-globin is located on chromosome 11 and the gene for a...
31.In humans, the gene for B-globin is located on chromosome 11 and the gene for a globin, which is another component of the hemoglobin protein, is located orn chromosome 16. Would you expect these two chromosomes to pair with each other during meiosis? Why or why not?
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Consider a standard PCR reaction. If instead of including double-stranded DNA from a biological sample, you ...
Consider a standard PCR reaction. If instead of including double-stranded DNA from a biological sample, you added mRNA molecules from a biological sample, the reaction would… Can you please explain why the answer is not E A. work, but would yield less product because you started off with single-stranded template B. A and D are correct C. work, but would generate much shorter products D. not work because you would also need to replace the dNTPs with NTPs for the...
What part(s) of a nucleotide will occupy the major & minor groove of a double-stranded DNA...
What part(s) of a nucleotide will occupy the major & minor groove of a double-stranded DNA molecule? WHY? What parts are found in the DNA backbone? WHY? Where would a Restriction Endonuclease associate with DNA? How long is a double-stranded DNA molecule that is 2 x 105 bp? How many nucleosomes would be required to package this DNA if it were in a Eukaryote? When chromatin from any eukaryote is digested briefly with micrococcal nuclease (an endonuclease) and fractionated using...
This figure represents supercoiled, circular, double-stranded DNA: If this molecule of DNA originated as a linear molecule with a linking number (L) of 30, which was then circularized and unwound, the L for the unwound circular molecule would be O32 O 18 O 28 O 30 20
All are the same diagrams
Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2 3-TTAGCATACGCTTCGGGAATTGA - 5 The number of mRNA codons in the corresponding transcript is: A 1 3.4 OC5 E Cannot be determined Consider the double-stranded DNA sequence of a gene below: Strand 1: 5'-AATCGTATGCGAAGCCCTTAACT-3' Strand 2. 3'-TTAGCATACGCTTCGGGAATTGA-5 The number of amino acids in the corresponding peptide is: OOOOO du . w Consider the following double-stranded region of a gene below: Strand 17...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
31.In humans, the gene for B-globin is located on chromosome 11 and the gene for a globin, which is another component of the hemoglobin protein, is located orn chromosome 16. Would you expect these two chromosomes to pair with each other during meiosis? Why or why not?
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
What part(s) of a nucleotide will occupy the major & minor groove of a double-stranded DNA molecule? WHY? What parts are found in the DNA backbone? WHY? Where would a Restriction Endonuclease associate with DNA? How long is a double-stranded DNA molecule that is 2 x 105 bp? How many nucleosomes would be required to package this DNA if it were in a Eukaryote? When chromatin from any eukaryote is digested briefly with micrococcal nuclease (an endonuclease) and fractionated using...
Most questions answered within 3 hours.
-
Casey is on trial under criminal allegations that she engaged in
fraudulent behavior at the company...
asked 7 minutes ago -
1. A boy stands on one end of a boat, and then walks to the
other...
asked 2 minutes ago -
Surplus Styles is a manufacturer of hair care products,
including shampoos, conditioners, and hair gels. The...
asked 5 minutes ago -
Using an income-expenditure diagram, use the infinite line and
double-drop line tools to show the economy...
asked 13 minutes ago -
Which expression computes a pseudorandom integer between -10 and
10 using rand()
from cstdlib?
A. (rand(...
asked 20 minutes ago -
Roybus, Inc., a manufacturer of flash memory, just reported that
its main production facility in Taiwan...
asked 28 minutes ago -
Two capacitors connected in parallel produce an equivalent
capacitance of 45.0 μF but when connected in...
asked 37 minutes ago -
The differences between the two sets of dependent data are -1,
2,-,2, 2. Round to the...
asked 54 minutes ago -
A χ2-curve, looking at the relationship between age and hours
spent working at an office per...
asked 1 hour ago -
The pH of a sample of water from a river is 5.0. A
sample of effluent from...
asked 2 hours ago -
At the beginning of the period, the Fabricating Department
budgeted direct labor of $136,500 and equipment...
asked 2 hours ago -
Please answer all
____ 28. Rent control is usually
justified on the grounds that it protects...
asked 2 hours ago