In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand...
In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand for one gene may be the nontemplate strand for another gene.
true or false
Homework Answers
Add Answer to:
In a long double-stranded DNA molecule containing the genetic
information for many genes, the template strand...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic reco...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A...
Q1 The immediate template for PCR amplification is double stranded DNA. (True or False) Q2 A primer is a DNA oligonucleotide. (True or False) Q1 Denaturation of DNA double helix takes place at 96 C. (True or False) Q2 A primer is a single stranded DNA oligonucleotide. (True or False) Q1 16 doubled stranded DNA fragments are obtained from one DNA double stranded template after 4 cycles of PCR. (True or False) Q2 Denaturation of DNA double helix takes place...
Some genes are transcribed using one strand of DNA as the template, while other genes are...
Some genes are transcribed using one strand of DNA as the template, while other genes are transcribed using the other strand. Explain how this is possible and why this is advantageous to the cell, and for storing genetic information.
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
compare selection and mutation 1. DNA molecules in the cells exist as a........ 2. DNA carry...
compare selection and mutation
1. DNA molecules in the cells exist as a........ 2. DNA carry the information to build and maintain the cells life by four letters of genetic language True False 3. The term phenotype is used to describe all of the organism's genetic information True / False 4. All of the organism DNA encode genes True/ False 5. Bacteria have one chromosome which is circular structure associated with proteins (no histones) True False 6. In the process...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.
You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...
You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
compare selection and mutation
1. DNA molecules in the cells exist as a........ 2. DNA carry the information to build and maintain the cells life by four letters of genetic language True False 3. The term phenotype is used to describe all of the organism's genetic information True / False 4. All of the organism DNA encode genes True/ False 5. Bacteria have one chromosome which is circular structure associated with proteins (no histones) True False 6. In the process...
You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...
Most questions answered within 3 hours.
-
The blues made its way into many kinds of music. Eric Clapton,
The Beatles, and Elvis...
asked 20 minutes ago -
If you’re standing at the bottom of a hill and asked to evaluate
it while being...
asked 1 hour ago -
1. Which region has taken the lead in the world of
e-waste handling?
a) European Union...
asked 1 hour ago -
A 8.15- g bullet from a 9-mm pistol has a velocity of 366.0 m/s.
It strikes...
asked 2 hours ago -
The outstanding bonds of Alpha Extracts have a yield to maturity
of 7.4 percent and a...
asked 2 hours ago -
The Problem: The Case of the Harmonizing Vacations
Your CEO is exploring partnering with a European...
asked 4 hours ago -
A chemical equation is balanced by adding coefficients in front
of some formulas so that the...
asked 4 hours ago -
From the literature (reference your sources): What are the
lattice parameters of calcite and aragonite? Why...
asked 4 hours ago -
Your system is rejecting the question am asking which is
preceded by a case study. It...
asked 4 hours ago -
3. On January 2, 2000, Larry creates a trust with himself as
trustee. Larry as trustee...
asked 4 hours ago -
A member of the volleyball team spikes the ball. During this
process, she changes the velocity...
asked 4 hours ago -
Are adult gamers less likely to use a gaming console (Xbox,
PlayStation, Wii, etc...) than teen...
asked 5 hours ago