Translate this 5’ to 3’ sequence of DNA into protein. Use the single letter code for...
Translate this 5’ to 3’ sequence of DNA into protein. Use the single letter code for the protein sequence. When you come to a stop codon your protein fragment is complete. Indicate the charge of the peptide at pH 7.0.
a t g a a g c a a g g t t t g c a a c t c a g g c t t a g c c a a c a a c t g g c g a t g t g a
Homework Answers
A T G A A G C A A G G T T T G C A A C T C A G G C T T A G C C A A C A A C T G G C G A T G T G A
Its mRNA formed after transcription will be
Pre mRNA- UAC UUC GUU CCA AAC GUU GAG UCC GAA UCG GUU GUU GACD CGC RUAC ACU
In this sequence there is no stop codon so the mRNA will translate completely into protein.
And we will get protein sequence as:
YFVPNVESESVDRYT
The net charge on the protein at pH 7 will be -, because the negatively charges molecules are one more than positively charged amino acids
Add Answer to:
Translate this 5’ to 3’ sequence of DNA into protein. Use the
single letter code for...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
3. Translation. According to the rules of the genetic code, there are six different reading frames...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the...
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the mRNA sequence of this stretch of DNA. (how it would read if this gene would be transcribed) #2 Write the protein sequence in single letter code that corresponds to the mRNA sequence.
ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the...
ASSIGNMENT For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3’—A T T G C T T A C T T G C A T -- 5’ DNA 5’-- Does it matter which strand is the ‘code strand’? The following two sequences look identical, except one runs 3’-5’ and the other 5’-3’. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3’ and 5’ ends). Use the Universal triplet code to...
6. A peptide has the sequence Cys-His-Phe-Glu-Ala-Arg a. Write the single letter sequence of the peptide...
6. A peptide has the sequence Cys-His-Phe-Glu-Ala-Arg a. Write the single letter sequence of the peptide b. Calculate the percentage and indicate the charge of the predominant peptide species at pH 6.5. Use the following pKa values: pKa Cys = 8.3, pKa N-terminus = 10.8, pKa His =6.0, pKa Glu = 4.3, pKa Arg = 12.5, pKa C-terminus =2.0 c. What is the charge of the peptide at pH 4.3? d. Draw the chemical structure of the predominant peptide species...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
6. A peptide has the sequence Cys-His-Phe-Glu-Ala-Arg a. Write the single letter sequence of the peptide b. Calculate the percentage and indicate the charge of the predominant peptide species at pH 6.5. Use the following pKa values: pKa Cys = 8.3, pKa N-terminus = 10.8, pKa His =6.0, pKa Glu = 4.3, pKa Arg = 12.5, pKa C-terminus =2.0 c. What is the charge of the peptide at pH 4.3? d. Draw the chemical structure of the predominant peptide species...
Most questions answered within 3 hours.
-
3) What are the typical social structures in a global city?
asked 31 minutes ago -
Luther Corporation
Consolidated Balance Sheet
December 31, 2019 and 2018 (in $ millions)
Assets
2019
2018...
asked 33 minutes ago -
(Expected rate of return and risk) Carter Inc. is evaluating a
security. Calculate the investment’s expected...
asked 3 hours ago -
What specific indicators can point to lack of progress for
African Americans in American society?
asked 4 hours ago -
1-The Electrons in a beam are moving at 2.7×108 m/s in an
electric field of 15000...
asked 4 hours ago -
A gas tank is a vertical cylinder. It has a radius of 1m, a
height of...
asked 4 hours ago -
Accent Software faces the following conditions. All of these
support Accent’s use of a market-penetration pricing...
asked 5 hours ago -
A mathematically inclined friend emails you the following
instructions: "Meet me in the cafeteria the first...
asked 5 hours ago -
A monopoly sells in two countries . The demand curves in the two
countries are p1...
asked 6 hours ago -
A .15kg rubber ball is bounced off a wall. Before hitting the
wall, the ball moves...
asked 7 hours ago -
A manufacturing company preparing to build a new plant is
considering three potential locations for it....
asked 7 hours ago -
B. If compound Y has approximately the same values of solubility
in toluene as compound X,...
asked 8 hours ago