Question

Problem 1: Most humans are trichromats, which means they have three different pigments in their eyes that are sensitive to three different parts of the color spectrum. Dichromats have only two such pigments and see fewer colors. The three pigments in trichromat animals, like humans, are coded for by opsin genes called sws, MWs, and LWS (which stands for short-, medium-, and long- wavelength sensitive. respectively). These genes have been duplicated many times in evolutionary history and in fact, the LWS gene is a duplicated and mutated copy of the MWS gene. Part 1. DNA structure & function (10 pts) The DNA sequence below represents a portion of the MWS opsin gene in humans. TATAGGGCATGGCGTTTAGCTGGAGTACCTTTTGGGCGGCGGTGTGGTAGAGCGT CG-3 The LWS opsin gene, located on the same chromosome, is a mutated copy of the MWS opsin gene. LWS has the same DNA sequence as MWS, except that it has undergone a missense mutation where the first guanine in the bolded and underlined sequence is mutated to thymine. 1. (10 pts) Using your understanding of DNA structure, determine the polypeptide sequence that represents the LW'S gene. Complete each step in the process as indicated below, and show directionality where important. TATAGGGCATGGCGTTTAGCTGGAGTACCTTTTGGGCGGCGGTGTGGTAGAGCGT CG-3 Promoter:5'-TATAGGG-3 Terminator: 5-CGTCG-3 Intron: 5-GTACCT-3 Coding strand: (Ipts) Template strand: (1pts) pre-mRNA: (2pts) mRNA: (2pts) Page 2 of 11

Answer 1