1. According to the Wobble hypothesis, we know that one tRNA can recognise and bind to more than one codon as a less prcise base pairing take place between the 3rd base of the codon and the 1st base of the anticodon of the tRNA.
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
QUESTION 11 Meselson and Stahl had obtained the resuk below, what would have been there conclusion First Generation Replication Replication N4 14 NINIS NAS N15 DNA replication is conservative DNA replication is semi-conservative DNA replication is dispersive None of the above QUESTION 12 If one strand of DNA Is CGGTAC in the 5-3 direction, what is the corresponding complementary strand of DNA in the 53' direction? GCCTAG ©GTACG TAACGT GCCATG CATGGA QUESTION 13 Which of the following statements regarding the...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...