Which of the following is specifically used to determine the lengths of the DNA fragments in the samples?
Loading Dye
Molecular Weight Markers
Running Buffer
Positive Electrode
Molecular weight marker is specifically used to determine the lengths of the DNA fragments in the samples.( marker DNA have fix length of fragment which gives clear cut reference size for targeted fragment ; loading dye used for increase the density of DNA, running buffer maintain pH and allow current flow; positive electrode complete electric circuit.)
Which of the following is specifically used to determine the lengths of the DNA fragments in the samples?
The molecular weight marker is an example of a ["Positive" OR "Negative"] control. Which would it be? In relation to this what would be the the main goal of loading dye in gel electrophoresis? A. To make the reaction run faster. B. It is a positive control. C. To measure the base pair size of the DNA fragments. D. To weigh down the samples. Its either A or C correct but which one between the two im confused?
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
Which of the following is an accurate description of the probes used in DNA microarrays? Question 4 options: Radiolabeled single stranded DNA fragments used to visualize complementary DNA bound to a solid surface cDNA copies of fragmented RNA isolated from samples cells Specific DNA fragments labeled with a fluorophore and bound in an ordered pattern to a microchip Specific DNA fragments bound in an ordered pattern to a microchip More than one of these responses is correct
10. You electrophorese a DNA sample containing two linear fragments of DNA, one large and one small. Which one do you expect to find closest to the negative electrode? 11. Why do you not increase the voltage during electrophoresis? It would speed up the process considerably. What if you mistakenly used distilled water instead of TAE buffer for your electrophoresis? Would there be any difference in the outcome? 12. 13. What does ethidium bromide do?
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
The glycoproteins found on red blood cells which determine your blood type, are also known as Question options: Agglutinins Agglutinogens Aggluninations Nucleotides How many chromosomes do humans have? Question options: 2 23 92 46 What blood type is the universal recipient? Question options: AB+ O- A+ B- After completing electrophoresis, large DNA fragments will be located ______________. Question options: At the bottom of the gel In the middle of the gel At the top of the gel Both at the...
3) Image from Biotechnology Explorer Kit, BIO RAD Analysis of DNA Fragments The data you entered for the lambda Hindill digest were the relative positions of DNA bands of known size. Since the exact size and position of these fragments are known, they can be used as standard reference points to estimate the size of unknown fragment bands. A set of fragments of known sizes is called a molecular weight ruler or standards or marker (or sometimes a ladder because...
Which of the following enzymes joins the paired sticky ends of DNA fragments? a. reverse transcriptase b. restriction enzymes c. DNA ligase d. DNA polymerase e. helicase
help! 14. Which of the following factors does effect on DNA fragments separation during electrophoresis a. Size b. Electrical charge c. Nucleotides sequences d. All of the above Match the following with q 15-18 a. A necessary cofactor for DNA polymerization b. To break cell membrane open c. Confirm plant-based sample d. Detection of GMO e. Cell membrane lysis 15. Salt solution and heat 16. Primer of CaMw promoter 17. Primer of Nopalin Synthetase virus terminator 18. Magnesium chloride 19-...
Which of the following DNA samples has the highest melting temperature? DNA that is 40% C DNA that is 30% T DNA that is 30%G DNA that is 40%A