The molecular weight marker is an example of a ["Positive" OR "Negative"] control. Which would it be?
In relation to this what would be the the main goal of loading dye in gel electrophoresis?
A. To make the reaction run faster.
B. It is a positive control.
C. To measure the base pair size of the DNA fragments.
D. To weigh down the samples.
Its either A or C correct but which one between the two im confused?
DNA ladder with respect to the gel electrophoresis is a positive control, because the DNA ladder contains DNA fragments, the presence or absence of bands in the ladder helps us to find out whether we did any mistakes during the gel making or connecting the gel to the electric supply, DNA is negatively charged so the wells have to be close to the negative electrode so that the DNA fragments can move through the gel towards positive electrode, and if the concentration of the gel is very less and if the gel is overrun we cannot find any bands in the ladder. so the DNA ladder is a positive control.
DNA ladder consists of DNA fragments of different lengths, the distance migrated through the gel depends on the length of the DNA fragments, larger DNA molecules migrate slowly and smaller fragments migrate faster, distance moved along the gel depends on the concentration of the gel, so the DNA ladder is used to determine the size of the fragments in the gel.
C. To measure the base pair size of the DNA fragments.
The molecular weight marker is an example of a ["Positive" OR "Negative"] control. Which would it be?...
Which of the following is specifically used to determine the lengths of the DNA fragments in the samples? Loading Dye Molecular Weight Markers Running Buffer Positive Electrode
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Can anyone show me step-by-step on how to do the agarose calculations? This week we will run the PCR reactions on an agarose gel and analyze the results. Safety notes: Ethidium bromide is a potent mutagen. Wear gloves when handling containers containing ethidium bromide, when handling gels that have been stained in ethidium bromide, and when working with the computer attached to the gel-doc system. Protocol I. Pouring agarose gels I. Using 10x TAE, prepare 50 ml of 3% (w/v)...
Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the horitzontal. I need help figuring out where to start and what to do. Please help! The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
PARTB Experiment 1 (201). Molecular Weight Determination The 1-1. You will be in the wild with me is found in rabbit serum. This protein is called serumbumin. The sandard unknown proteins and the rabbit serum prins for this experimentarehe pre- tined to allow you to follow the portion during crophews Background Information A first step in the analysis of a protein in the molecular biology laboratory frequently involves determination of its sie or molecular weight. The molecular weight of a...
Hi can someone help me understand part C and why the drawn in red lines are where they are. Basically from the bp given how can I go back to cm so I can drawn them into the picture provided? Do not need help with A or B. The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...
8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to run an in vitro experiment to characterize the activity of the purified complex. Your molecular toolbox includes: (1) a 400-base-pair DNA molecule that has a single recognition site for the restriction endonuclease EcoRI, an enzyme that cleaves internal sites on double-stranded DNA (dsDNA); (2) purified EcoRI enzyme; (3) purified DNase I, a DNA endonuclease that will cleave dsDNA at nonspecific sites if they are...
Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...