Is ncRNA linked to mRNA by covalent bonds, base complementary or both? What effect does this...
Is ncRNA linked to mRNA by covalent bonds, base complementary or both? What effect does this have on the transcript?
Homework Answers
no ncRNA linked to mRNA by base complementary (hydrogen bond) like DNA double strand bind to each other, this bonding affecttranscript(mRNA) because these ncRNA like miRNA,siRNA bind complemantary to mRNA and form double stranded RNA molecule which then cleaved by RISC complex which used in gene silencing process. i.e. the bonding of ncRNA cleave the transcript or mRNA.
Add Answer to:
Is ncRNA linked to mRNA by covalent bonds, base complementary or
both? What effect does this...
what base in mRna transcript would represent the DNA templete sequence ?
what base in mRna transcript would represent the DNA templete sequence ?
Does arginine play a role in acid/base catalysis, covalent catalysis or both? Explain your answer?
Does arginine play a role in acid/base catalysis, covalent catalysis or both? Explain your answer?
11. What effect does an insertion mutation have on the mRNA reading frame, give an example?
11. What effect does an insertion mutation have on the mRNA reading frame, give an example?
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not...
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04 02 3
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not...
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04. 2 O 3
Why is it that strong covalent bonds and wear bonds are both essential in living organisms?
Why is it that strong covalent bonds and wear bonds are both essential in living organisms?
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand...
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand c) nucleotide tRNA sequence
how many covalent bonds does each carbon have in the Lewis structure?
how many covalent bonds does each carbon have in the Lewis structure?
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
18. The base pairs are held together primarily by a. Covalent bonds b. Hydrogen bonds c. lonic bo...
18. The base pairs are held together primarily by a. Covalent bonds b. Hydrogen bonds c. lonic bonds d. Gyrases 19. How many hydrogen bonds between Adenine and Thymine? a. b. 2 c. 3 d. 4 20. How many hydrogen bonds between Cytosine and Guanine? b. 2 d. 4 21. Which ones are weaker? a. Hydrogen bonds b. Covalent bonds 22. The nature of the double helix is that it is: a. Parallel arranged b. Perpendicularly arranged c. Antiparallel arranged...
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04 02 3
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04. 2 O 3
18. The base pairs are held together primarily by a. Covalent bonds b. Hydrogen bonds c. lonic bonds d. Gyrases 19. How many hydrogen bonds between Adenine and Thymine? a. b. 2 c. 3 d. 4 20. How many hydrogen bonds between Cytosine and Guanine? b. 2 d. 4 21. Which ones are weaker? a. Hydrogen bonds b. Covalent bonds 22. The nature of the double helix is that it is: a. Parallel arranged b. Perpendicularly arranged c. Antiparallel arranged...
Most questions answered within 3 hours.
-
1. What are stored procedures?
2. What purpose do stored procedures serve?
3. Name and describe...
asked 3 minutes ago -
Calculate the slope of the plot of lnk vs. 1/T
for the reaction. Be sure to...
asked 4 minutes ago -
Suppose X is a random variable whose density is f(x) = cx(1 - x)
for 0...
asked 7 minutes ago -
Below is an ANOVA
summary table. Based on these data, would you follow this ANOVA up...
asked 7 minutes ago -
A golf ball rolls off a horizontal cliff with an initial speed
of 11.7 m/s. The...
asked 11 minutes ago -
1. An experiment was run where varying amounts of HClO and KClO
solutions were mixed and...
asked 23 minutes ago -
This is symbolized by a circle over a single line in an entity
relationship diagram. It...
asked 26 minutes ago -
National well-being can be measured using the Per-capita GDP
(per-capita) and the Human Development Index (HDI)....
asked 27 minutes ago -
A failure of an engine control unit causes it to fail an average
of 0.1 times...
asked 40 minutes ago -
A siren on an emergency car moving with velocity 90 km/hour
produces the sound with frequency...
asked 41 minutes ago -
Consider the schema below that models a bank’s branches,
customers and their accounts and loans. Provide...
asked 48 minutes ago -
What kinds of policies should be considered when individuals
decisions may likely impact public expense? For...
asked 56 minutes ago