Which part of the Central DOgma do some viruses violate? a. DNA is the template for...
Which part of the Central DOgma do some viruses violate? a. DNA is the template for RNA b. RNA is the template for proteins c. protein is the template for proteins d. proteins make DNA
Homework Answers
Ans. Correct option: A. DNA is the template of RNA.
Central dogma: “DNA--------------> RNA -------------> Protein”; where, DNA serves as template for RNA; and RNA later serves as the template for protein synthesis.
Some viruses violate the first step “DNA--------------> RNA”. They use RNA as template for the synthesis of DNA through reverse transcriptase activity. These viruses are thus also called retroviruses because of their ability to carry out reverse transcription.
Option: b. RNA is template for protein. The statement is true, is a part of central dogma but viruses do NOT violate it.
Option c and d. Statements are Incorrect, and not a part of central dogma, too.
Add Answer to:
Which part of the Central DOgma do some viruses
violate? a. DNA is the template for...
QUESTION 9 In some viruses, the central dogma of biology is altered. Which of the following...
QUESTION 9 In some viruses, the central dogma of biology is altered. Which of the following is an example of this alteration? a) Information flows directly from DNA to protein b) Information flows from DNA to RNA to protein. c) Information flows from protein to DNA to protein. d) Information flows from protein to DNA to RNA e) Information flows from RNA to RNA to protein
Part D Which of the following statements about the central dogma is correct? Drag "True" or...
Part D Which of the following statements about the central dogma is correct? Drag "True" or "False" to the end of each statement. Reset Help True The central dogma predicts that a change in a DNA sequence will result in a change in an RNA False sequence. Transcription is the process of using a single strand of DNA as a template to produce a complementary sequence of RNA. The central dogma predicts that mRNAs are transcribed into DNA. The arrows...
The Central Dogma states that DNA is _ into RNA, which is into proteins. If a...
The Central Dogma states that DNA is _ into RNA, which is into proteins. If a mutation occurs in a cell, it happens on the which could destroy the function of a
1. The central dogma allows information flow in all of these directions EXCEPT (A) DNA to...
1. The central dogma allows information flow in all of these directions EXCEPT (A) DNA to DNA (B) DNA to RNA (C) RNA to protein (D) Protein to DNA 2. The genetic code has all the following characteristics EXCEPT (A) The genetic code directs a specific amino acid to polypeptide (B) Five nucleotides comprise a codon (C) The genetic code is universal (D) The genetic code is conserved 3. Which description about restriction enzymes is true? (A) Recognize specific 4-8...
Please label the image to review recent changes made to the central dogma of biology. TRNA...
Please label the image to review recent changes made to
the central dogma of biology.
TRNA Proteins Transcription of • DNA Translation of RNA Ribosome (rRNA + protein) Several types of regulatory RNAs control transcription and translation mRNA Regulatory RNAS DNA RNA
Please explain the following question and answer all 29. The central dogma of molecular genetics is...
Please explain the following question and answer all
29. The central dogma of molecular genetics is that DNA encodes an mRNA, and mRNA allows proteins to be made. In the lecture on making cDNA libraries there was a statement that jokingly) said "central dogma be damned". What is it about making a cDNA library that goes against the central dogma? A. although a primer is required to make a cDNA, the primer is simply a long run of "T's", B....
Is DNA replication part pf central Dogma? can anyone lists steps of what central dogma is...
Is DNA replication part pf central Dogma? can anyone lists steps of what central dogma is in detail
The central dogma of molecular biology consists of which of the following steps? a) Ribosomes are...
The central dogma of molecular biology consists of which of the following steps? a) Ribosomes are involved in the translation process Ob) RNA is translated into proteins O c) All of the above d) DNA is transcribed into RNA e) The enzyme RNA polymerase is involved in transcription Ribosomes bind protein and synthesize RNA. O a) True b) False Question 9 (3 points) Lysosomes use_ enzymes to carry out_ in -- -- polymers. reactions that break bonds O a) acid...
1a. Which of the following DNA strands, the top or bottom, would serve as a template...
1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding b. What would be the resulting RNA sequence (written 5′→3′ )? 2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the...
Central Dogma and the Spider Silk Goats Introducing DNA Sequences called Promoters So why is the...
Central Dogma and the Spider Silk Goats Introducing DNA Sequences called Promoters So why is the spider sillk protein ONLY made in A PROMOTER is a non-coding DNA the mammary tissues ofsequence that controls the goat?!?!?! when and where a gene is turned on" (transcribed)! We know enough about promoters that we can engineer where a particular gene is expressed (switched on) and its protein is made. Promoter Transcription unit 3' DNA Start point RNA polymerase We were unable to...
QUESTION 9 In some viruses, the central dogma of biology is altered. Which of the following is an example of this alteration? a) Information flows directly from DNA to protein b) Information flows from DNA to RNA to protein. c) Information flows from protein to DNA to protein. d) Information flows from protein to DNA to RNA e) Information flows from RNA to RNA to protein
Part D Which of the following statements about the central dogma is correct? Drag "True" or "False" to the end of each statement. Reset Help True The central dogma predicts that a change in a DNA sequence will result in a change in an RNA False sequence. Transcription is the process of using a single strand of DNA as a template to produce a complementary sequence of RNA. The central dogma predicts that mRNAs are transcribed into DNA. The arrows...
The Central Dogma states that DNA is _ into RNA, which is into proteins. If a mutation occurs in a cell, it happens on the which could destroy the function of a
1. The central dogma allows information flow in all of these directions EXCEPT (A) DNA to DNA (B) DNA to RNA (C) RNA to protein (D) Protein to DNA 2. The genetic code has all the following characteristics EXCEPT (A) The genetic code directs a specific amino acid to polypeptide (B) Five nucleotides comprise a codon (C) The genetic code is universal (D) The genetic code is conserved 3. Which description about restriction enzymes is true? (A) Recognize specific 4-8...
Please label the image to review recent changes made to
the central dogma of biology.
TRNA Proteins Transcription of • DNA Translation of RNA Ribosome (rRNA + protein) Several types of regulatory RNAs control transcription and translation mRNA Regulatory RNAS DNA RNA
Please explain the following question and answer all
29. The central dogma of molecular genetics is that DNA encodes an mRNA, and mRNA allows proteins to be made. In the lecture on making cDNA libraries there was a statement that jokingly) said "central dogma be damned". What is it about making a cDNA library that goes against the central dogma? A. although a primer is required to make a cDNA, the primer is simply a long run of "T's", B....
The central dogma of molecular biology consists of which of the following steps? a) Ribosomes are involved in the translation process Ob) RNA is translated into proteins O c) All of the above d) DNA is transcribed into RNA e) The enzyme RNA polymerase is involved in transcription Ribosomes bind protein and synthesize RNA. O a) True b) False Question 9 (3 points) Lysosomes use_ enzymes to carry out_ in -- -- polymers. reactions that break bonds O a) acid...
Central Dogma and the Spider Silk Goats Introducing DNA Sequences called Promoters So why is the spider sillk protein ONLY made in A PROMOTER is a non-coding DNA the mammary tissues ofsequence that controls the goat?!?!?! when and where a gene is turned on" (transcribed)! We know enough about promoters that we can engineer where a particular gene is expressed (switched on) and its protein is made. Promoter Transcription unit 3' DNA Start point RNA polymerase We were unable to...
Most questions answered within 3 hours.
-
In
your own words, please explain the essay by John Keynes wrote "The
End of Laissez...
asked 2 minutes from now -
How are the matrix and pixels related? Why are smaller
pixels better for diagnostic quality?
asked 25 seconds ago -
2. An AC generator has 80 rectangular loops on
its armature. Each loop is 11 cm...
asked 2 minutes ago -
Please help me with this question. Consider Aldi’s current and
potential geographic markets (see Exhibit 4...
asked 4 minutes ago -
What are the main components of the fermentation process and
give an explanation of each? Include...
asked 29 minutes ago -
Explain which types of cells in the body (belonging to which
organs, etc.) are sensitive to...
asked 33 minutes ago -
A single cable supports an 703-kg elevator car. What is the
tension in the cable when...
asked 35 minutes ago -
among the three different ways to link CSS specifications to an
HTML document (inline CSS, document...
asked 47 minutes ago -
(1) Write the net ionic equation for the reaction that occurs
when equal volumes of 0.191...
asked 1 hour ago -
On the night of April 18, 1775, a signal was to be sent from the
Old...
asked 57 minutes ago -
For each of the following strong base solutions, determine
[OH−],[H3O+], pH, and pOH 4.8 x 10^-4...
asked 53 minutes ago -
The magnitude of the electric field inside a capacitor is 6.6 x
106 N/C. What is...
asked 52 minutes ago