Homework Answers
WT DNA sequence: TACGGCAGTCCTTCTGCAACT
WT RNA sequence: AUGCCGUCAGGAAGACGUUGA
WT protein sequence: Met-Pro-Ser-Gly-Arg-Arg-stop
After the removal of the second G in the second codon
Mutant DNA sequence: ATGCGTCAGGAAGACGTTGA
Mutant RNA sequence: AUGCGUCAGGAAGACGUUGA
Mutant protein sequence: Met-Arg-Gln-Glu-Asp-Val-stop
Add Answer to:
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
The DNA sequence shown encodes the last amino acids of a protein that has a total...
The DNA sequence shown encodes the last amino acids of a protein that has a total of 270 amino acids. The bolded base pairs indicate the translation reading frame. 5’ …….GCT AAG TAT TGC TCA AGA TTA GGA TGA TAA ATA ACT TGG 3’ 3’ …….CGA TTA ATA ACG AGT TCT AAT CCT ACT ATT TAT TGA ACC 5’ Which is the template strand for transcription? Explain.
7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary...
7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary RNA sequence: Write the 3-letter amino acid sequence:
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this...
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides! TAC AAT ACA ACT
An mRNA sequence of 18 nucleotides codifies for a polypeptide containing___. 18 amino acids 56 amino...
An mRNA sequence of 18 nucleotides codifies for a polypeptide containing___. 18 amino acids 56 amino acids 6 amino acids 36 amino acids
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA?...
QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA? Follow the normal rules for gene expression 5-AGCAAUAUGGCGAUUCGCUGAGUACCU-3 SecondA base UUS Ty UCC UGA CCU CAU CUC CCC First RNA beweisend) Third CO DO CODO<O> RNA base and GU AC U
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary RNA sequence: Write the 3-letter amino acid sequence:
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA? Follow the normal rules for gene expression 5-AGCAAUAUGGCGAUUCGCUGAGUACCU-3 SecondA base UUS Ty UCC UGA CCU CAU CUC CCC First RNA beweisend) Third CO DO CODO<O> RNA base and GU AC U
Most questions answered within 3 hours.
-
Assume ABC Company has asked you to not only prepare their 2017
year-end Balance Sheet but...
asked 1 minute ago -
Explain in detail (not just enumerate) each of Koch’s
postulates to determine the etiology of a...
asked 3 minutes ago -
You have just had a new set of tires put on your car, and now
the...
asked 6 minutes ago -
Please answer ASAP 2) Choose a point at random from the unit
square [0, 1] ×...
asked 21 minutes ago -
Draw the Lewis structures and determine which of these
molecules has a central atom that unavoidably...
asked 21 minutes ago -
Do we typically carry antibodies against the RH antigen in our
blood plasma?
asked 24 minutes ago -
What are the differences between an antibiotic, a semisynthetic,
and a synthetic as types of antimicrobials?
asked 20 minutes ago -
One mole of oxygen gas is at a pressure of 5.90 atm and a
temperature of...
asked 27 minutes ago -
The primary side of a transformer has 935 turns and is connected
to 118 Volts A/C....
asked 26 minutes ago -
This must be done in Java and it must contain a public static
void (string []args)...
asked 29 minutes ago -
An economy has a Cobb–Douglas production function:
Y=Kα(LE)1−αY=Kα(LE)1−α
The economy has a capital share of 0.30,...
asked 44 minutes ago -
60.0 mL of a silver chlorate solution with a concentration of
0.654 M is mixed with...
asked 49 minutes ago