An mRNA sequence of 18 nucleotides codifies for a polypeptide containing___. 18 amino acids 56 amino...
An mRNA sequence of 18 nucleotides codifies for a polypeptide containing___.
18 amino acids
56 amino acids
6 amino acids
36 amino acids
Homework Answers
6 amino acids
3 nucleotides form a single codon. Each codon codes for a single amino acid. Thus if there are 18 nucleotides then there would be 18/ 3 or 6 codons, thereby coding for 6 amino acids.
Add Answer to:
An mRNA sequence of 18 nucleotides codifies for a polypeptide
containing___.
18 amino acids
56 amino...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA,...
Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA, polypeptide chains c) mRNA, tRNA, polypeptide chains d) rRNA, tRNA, amino acids Teacher says a is wrong
How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences...
How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences of a protein?
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False;...
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False; in translation codon nucleotides are bound directly to amino acids False; in translation nucleotides are matched by complementarity but amino acid sequence is unrelated True; codons matching anti-codons is the only process where complimentary nucleotides associate True; nucleotides on mRNA and on tRNA are complimentary (the operon and anti-codon) and the tRNA carries a single amino acid
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA...
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA to represent all of the codons needed to correctly translate the protein. 50 O 100 147 150 153
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
If the following mRNA code was synthesized, what polypeptide sequence would be synthesized? Use the attached...
If the following mRNA code was synthesized, what polypeptide sequence would be synthesized? Use the attached genetic code to help you with your answer. 5' ACUGAUGCAACGCUAACAUAA 3' (use the 3-letter abbreviation for the amino acids and separate each amino acid with a "-". i.e. met-pro-phe-glu"
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many...
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA codons would be required? Question 9 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA ribonucleotides would be required?
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
A protein composed of fifty amino-acids would require a minimum of _ nucleotides in the mRNA to represent all of the codons needed to correctly translate the protein. 50 O 100 147 150 153
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA codons would be required? Question 9 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA ribonucleotides would be required?
Most questions answered within 3 hours.
-
2.
A particular sample of vinegar has a pH of 2.95.
Part A
If acetic acid...
asked 24 seconds ago -
1a.) A simple random sample of 100 Harvard undergraduates was
given a two-question astronomy test. 13%...
asked 5 minutes ago -
A spider hangs vertically from a thread of negligible mass. In
what situation, the tension in...
asked 6 minutes ago -
is an approach for addressing bottlenecks in a process or
system.
A. Utilization
B. Breakeven Analysis...
asked 27 minutes ago -
A 125 g sample of an unknown substance is heated to 93.6 °C and
then dropped...
asked 18 minutes ago -
How is a car horn like an earthquake? How is it different? Which
of the waves...
asked 22 minutes ago -
Currently, GH Co. sells 42,600 handbags annually at an average
price of $149 each. It is...
asked 47 minutes ago -
A boy of mass 60 kg and a girl of mass 40 kg are together and...
asked 50 minutes ago -
Which of the following best describes transferred-in costs?
A) they are the cost of transferring products...
asked 59 minutes ago -
Programming in C:
Write a program that accepts an integer and two floating-point
values (All three...
asked 1 hour ago -
In hypothesis testing, it is easier to reject H0 with
a ______________
directional test (one tail)...
asked 1 hour ago -
Requirements:
For this exercise you are to implement a small bioinformatics
library for operations with DNA...
asked 1 hour ago