ZuoTi.Pro
Question

Sometimes RNA forms double strands before the cell identifies and removes the double-stranded RNA. Draw and...

Sometimes RNA forms double strands before the cell identifies and removes the double-stranded RNA. Draw and label a detailed diagram of how you imagine a 2 nucleotide RNA molecule (sequence: 5’ A-G 3’) might hybridize to a complementary RNA molecule

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

The labelled diagram is in the following :

0 0
Add a comment
Know the answer?
Add Answer to:
Sometimes RNA forms double strands before the cell identifies and removes the double-stranded RNA. Draw and...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...

    DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'

  • Rabies is a single-stranded RNA virus that is a negative sense virus. Draw how a 6-nucleotide...

    Rabies is a single-stranded RNA virus that is a negative sense virus. Draw how a 6-nucleotide sequence of its genome would look (random sequence with all nucleotides represented). Please have the appropriate number of strands, different types of bonds and different components to the nucleotide in the drawing

  • Sometimes a single-stranded molecule of RNA is able to fold back on itself because the nucleotide...

    Sometimes a single-stranded molecule of RNA is able to fold back on itself because the nucleotide sequence on one part of the RNA is complementary to another part. This sequence motif directly results in a: Group of answer choices transcription factor binding site RNA polymerase hairpin-shaped structure membrane protein A large number of new mutations occuring in an animal genome every generation would be acceptable if: Group of answer choices there were good DNA repair mechanisms most of the genome...

  • 1. The virus hijacks the cell, and RNA polymerases produce the complement to the positive stranded...

    1. The virus hijacks the cell, and RNA polymerases produce the complement to the positive stranded RNA genome. We can call these strands negative strands, and they then serve as templates for RNA polymerases to produce their complement. How does the sequence of these strands, the complement to the negative strands, compare with the original viral genome? 2-1. RNA polymerases lack proofreading ability. Define proofreading ability and describe its importance in replication of DNA genomes. a. Why is this a...

  • Draw a figure of one double stranded DNA molecule that has initiated replication and produced two...

    Draw a figure of one double stranded DNA molecule that has initiated replication and produced two okazaki fragment in each lagging strand. The figure must include both template strands, all newly synthesized DNA molecules on both leading and lagging strands, all RNA primers, direction of chain growth for each fragment/strand indicated with arrowheads, direction of replication forks. Each molecule must be labeled with the origin of replication on both strands, leading and lagging strands labeled, template or newly synthesized, DNA...

  • 1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....

    1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...

  • 1a. Which of the following DNA strands, the top or bottom, would serve as a template...

    1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding b. What would be the resulting RNA sequence (written 5′→3′ )? 2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the...

  • Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...

    Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • Genetics To answer the prompts below, you will need to draw the chemical structure of the...

    Genetics To answer the prompts below, you will need to draw the chemical structure of the trinucleotide 5' - TCA - 3', labeling the 5' and 3' ends. Opposite this structure, draw the complementary trinucleotide to make a double-stranded DNA molecule. a. What is the complementary trinucleotide sequence from 5' to 3' (enter answer e.g. CGA)    b. How many non-covalent hydrogen bonds stabilize this structure?   c. How many covalent phosphate linkages stabilize this structure?   

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT