Question

Genetics To answer the prompts below, you will need to draw the chemical structure of the...

Genetics

To answer the prompts below, you will need to draw the chemical structure of the trinucleotide 5' - TCA - 3', labeling the 5' and 3' ends. Opposite this structure, draw the complementary trinucleotide to make a double-stranded DNA molecule.

a. What is the complementary trinucleotide sequence from 5' to 3' (enter answer e.g. CGA)   

b. How many non-covalent hydrogen bonds stabilize this structure?  

c. How many covalent phosphate linkages stabilize this structure?   

0 0
Add a comment Improve this question Transcribed image text
Answer #1

H-bond (3 Hydroxyl group) 5) Phosphate o-P-O- CH, Phoophoestor linkages. Phosphoester bond PO H cytosine Phosphodiestes band

Add a comment
Know the answer?
Add Answer to:
Genetics To answer the prompts below, you will need to draw the chemical structure of the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Part B Which of the following statements about DNA structure is true? View Available Hint(s) The...

    Part B Which of the following statements about DNA structure is true? View Available Hint(s) The pentose sugar in DNA is ribose. O ooo Hydrogen bonds formed between the sugar.phosphate backbones of the two DNA chains help to stabilize DNA structure Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Submit Part What is the complementary DNA sequence...

  • 8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...

    8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS

  • Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...

    Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...

  • I need the explanation for why is this the answer ! please. And answer the other...

    I need the explanation for why is this the answer ! please. And answer the other ones if you can. 3) If a species contains 23% A in its DNA, what is the percentage of guanine it would contain? A)23% B)46% C)25% D)44% E)27% 4) A nucleotide contains ADNA and RNA. Ba sugar and a phosphate. C)complementary purines and pyrimidines. D)RNA, protein, and lipids. E)a sugar, a phosphate, and a nitrogen-containing base. 5) In the Watson-Crick model of DNA, the...

  • en the letters write your answer as one word. Do not include the word STOP for...

    en the letters write your answer as one word. Do not include the word STOP for the stop codon For Item D: Draw the correct structure for the peptide on Part C. You can write the polypeptide as a condensed structure or as a skeletal structure Given the following single stranded DNA (coding strand answer the following questions 5-AAT ATG TAC GAC AAC GCC TAG AGG 3 a) (Ipt) What is the complementary strand (template strand; 3'-5" direction) for the...

  • 1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....

    1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...

  • multiple answers are possible! Which of the following statement about DNA is FALSE? When bacteriophage DNA...

    multiple answers are possible! Which of the following statement about DNA is FALSE? When bacteriophage DNA was shown to be the agent necessary for production of new phages, this was the early experiment demonstrating that DNA is the hereditary material. During DNA replication, two replication forks are formed to complete the synthesis of the entire chromosome in eukaryotes. During bacterial DNA replication process, replication forks move in opposite directions away from the origin of replication The molecular structure of DNA...

  • Question 14: The answers on 14 and 9 are incorrect. Answer the question 14 and question...

    Question 14: The answers on 14 and 9 are incorrect. Answer the question 14 and question 9 plz, thanks a lot. Helicase strand Refer to the above diagrams and match the components of the replisome with the description of their function A Extends an Okazaki fragment Single-stranded binding Holds DNA polymerase in place proteins (SSBPs) during strand extension H Topoisomerase Catalyzes the breaking of hydrogen bonds between base pairs to open Primase - leading strand the double helix D. Catalyzes...

  • Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the...

    Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.

  • The nonprotein portion required by complex enzymes for proper functioning called a(en) _________. zymogen substrate inhibitor...

    The nonprotein portion required by complex enzymes for proper functioning called a(en) _________. zymogen substrate inhibitor cofactor activator Which of the following are required to form a DNA nucleotide? ribose and phosphate deoxyribose and phosphate ribose, phosphate, and a base deoxyribose and a base deoxyribose phosphate, and a base How many hydrogen bonds link the following two strands of DNA 2 3 8 14 16 Which of the following enzymes is NOT involved in replication? DNA polymerase DNA ligase peptidyl...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT