If mRNA is mispliced and what was once an intron now becomes coding sequence, what may happen?
A. Will always have frameshift that will cause the appearance of new stop codons. B. New coding sequence could be spliced in-frame, could result in new amino acids and proteins C. Misplicing of mRNA can never occur D. None Above
Answer: Option A is correct.
Description:
When there is a mistake during splicing or if there is a mutation
in the splicing machinery or at the splice site junction, splicing
will not be proper. It would lead to the retention of introns or
skipping of exons.
The retention of introns most often leads to the production of
truncated proteins due to the appearance of an in-frame stop
codon.
Sometimes, although rare, intron retention may result in the production of a different protein sequence. These proteins are often non-functional or they may exhibit gain-of-function phenotypes.
If mRNA is mispliced and what was once an intron now becomes coding sequence, what may...
Please explain Why is a cap added to MRNA, but not to 1RNA or RRNA? Each of the three types of RNA are transcribed by different RNA polymerases. Only RNA polymerase II, involved in mRNA synthesis, contains a domain capable of interacting with enzymes that form the cap. Transcription and processing of MRNA occur in the nucleus, where cap binding proteins are found. These proteins, which add and modify the cap, are not found in the cytoplasm, where tRNA and...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
Please answer all questions. Oftentimes, unsaturated fatty acids are found in a fluid state at room temperature (e.g., olive oil). This is because unsaturated fatty acids contain a large number of ___________________. a. Hydrogen bonds b. Carbon-Carbon single bonds c. Carbon-Carbon double bonds d. Sulfide bonds e. Radioactive bonds Which of the following stages of aerobic cellular respiration generates the most ATP? a. Glycolysis b. Pyruvate breakdown c. Citric Acid Cycle (aka. Krebs Cycle) d. Oxidative phosphorylation e. Calvin Cycle...
1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...
1.What sequence upstream of AUG in prokaryotic mRNA facilitates recruitment of the 30S ribosomal subunit by base pairing with 16S ribosomal RNA? A. The Pribnow box B. The Shine Dalgarno sequence C. The TATA box D. The -35 region E. A stop codon 2.What is the role of the Shine-Delgarno sequence in prokaryotic mRNAs? It specifies the site of translation initiation - ? It specifies the site of polyA addition RNA splicing RNA export It specifies the site of translation...
41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will have which sequence in its anticodon e ERNA molecule which furnishes the we a) 3' UGT 5' b) 3' UCA 5. c) 3' ACU 5. d) 3' UGA 5' e) 3' TGA 5 During the replication of DNA, the DNA base sequence S'AGCAT" original strand will generate which of the following sequences on strand? a) 5' ATCAG 3. b) 5 AGCAT 3. c) 5'...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...