9.) How many times does the motif 5’-ATG-3’ appear in the whole sequence? How many times...
9.) How many times does the motif 5’-ATG-3’ appear in the whole sequence? How many times does it function as a start codon? Name two places that this motif may be present in the whole sequence, but NOT function as a start codon.
No need for the long explanation, just the answer will do
ACGCATACTCTACCGATAGATCAGAGGAGGCCTAAGTCTCTGCGGAAGTCGATTCCAGGGGATGACCTTACTATGGTCGGGAGGTTCTCTACGCGTCCCCGCCAGACAGCTAGATTTTGTTTTCTAAAGGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTTTATTTTACTCAATATTCGACAACGTGTTGACGTTGGAAGTGACCGAAATTAGAGCGTATGTAAGACGGGATACAAACAGGACGGTACCTCTTGTCACGATAGTGATTCAAGAGGTTCCAGGGGATGACCTTACTATGGTCGGGAGGTCACGTCGCCGTTCAGAACACGCATCAGCAGCATACAAGTCTAGCAGCCGTGATGTCTGTGTCCCTGAACCTCCCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTCAACGATAGCCACACAGCCATTCCTTTTGCCTCCAAAATAGGCTCTTGATTTGGAAGTTTAAAGATGAACTGTTCAAAGTAAATGCGCGTCATAGATGTCCCCCATATCCTCGTTTTCACCACAAACTTGCATCCACTACGTAAAGGTGCAAGAAACTTTGTTGTCAATTCAGAAACTGCCAATGCTTCACCAGAACGGGACACTTCATCACAGTTGCGATAGTCGGTTCAAGAGGTTCCAGGGGATGACCTTACTATGGTCGGGAGGTCACGTCGCCGTTCAGAACACGCATCAGCAGCACAACAGTAGAGGCCTTCAACGATTTACCTTTAGTCTCCATAAACTCGTGTTGACCGTGTTGGCAGTAGTTTGCATAAACAGCGTTGTTCACAACACCAAATTGGTCTAATTCATAATCACGAACTTTAAGTTCAATCTCATGGACTCCATTCATTCCTTTGCCTCCTTGCTGTTTGAAACATGAGAGAGGTTTGAAGGTCTCGATTACAAGTCTAGCAGCCGTGATGTCTGTGTCCCTGAACCTCCCCAAAGCGGGAGTTGCGATTTGTGCTCCGGAGAGGTAGGATAAGCGGTCGACTCGAAAAACAGGGAAACACCACGTGCATAGCCGGAGCCACTGTGCCGGTAGCTTTAAGCATTGCCCGCGGTATTTATAGGTTCTATTGTGATATACGGTGTAATACTTACGCGCGCGAGCGTAGTCATAGCGTACCGGCATCTCAGAGTAGTGACAAGGTTGACCAGCCAGCACTCTACGCAGAGGGCAATATATCGGAGCTCATGCCTATAAAGCTGGCGTAAATGGTTGCTTTTTTATCAGCTTGGCCTTGGGAAAACTTTGGCAATCTCAAGTATCTTCTCTACGCTCCATTAGCTGCACAAGTAGTGTACTCGTGGGTCTATGAAGAAGATATCTCAAAGGTTCTTTGGTGTATTCATATTCTCATAATCTGCGGTCTCAAAGCACATCGGTGAGCCCTCTCAGAACAGCATCGTTGTTCATGAACTATGGAGCGTTTTCAACAACATGCTTTTCGTGACTCGTACTCTAAGGATTAACCCTAAAGGGATGCACTTTAAACAGATATCGTCAGAACAGCGCGCCTCTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCAGCCCATCAATAGAGCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTCAACCTCCGCTCGGCTCGGGTACCTCGGTTATCGTGATCACGAATGGCACTGGGACAATTACATAATCCTACAAGCAATAATAGTGAGCCTGATCTGTTACATGTCACCACCATTGATGATGATGATAAACAGTCTTCCTCTGTGGAACACGAAAGGACTCTACGCATTAATTGTGCTACATGTGACTTTCTCAGAGCCTGGATACTACTTTCTGCACAGATCTTTCCACTGTAACAACTACTTCTTCACACATTACTAGGTCAGAATAAATTTACTTGTTGATTTCGAGCTCGATTAGAATAGGCCCCCTGTAGGTATGATTGTAGCGAGATGGGAGGTTCCGCGCCAGCTAAGAGATTGGTTTTCACCGACCGGGCTTGGATAGTGCTAGCTTACCCCCACGTCTTTCCACCTAAGTGCATGAGTCTGCAGTGGAACGCCGGCCGCTAACCTCCGCACTCACACGCATACTCTACCGATAGATCAGAGGAGGCCTAAGTCTCTGCGGAAGTTCCAGGGGATGACCTTACTATGGTCGGGAGGTCACGTCGCCGTTCAGATCGAACACGCATCAGCAGCATACAAGTCTAGCAGCCGTGATGTCTGTGTCCCTGAACCTCCCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTCAACCTCCGCTCGGCTCGGGTACCTCGGTTTCATCCCGGACTATCCCGCGACGTAATCTCTACGCGTCCCCGCCAGACAGCTAGATATAGTTTTCTAAAGGTATAAAACAGTCTAGAATGTCGACAGAAATGGAGGTCGTTAGTGTTCTTAAGTACCTTGACAACAAATCCATATTGGTCGTTGGAGCTGCTGGGTTCTTAGCAAATATCTTTGTGGAGAAGATATTAAGGGTGGCACCAAACGTGAAGAAACTCTATCTCCTTCTAAGAGCATCAAAAGGAAAATCTGCTACCCAGAGGTTTAACGACGAGATTTTGAAGAAAGATTTGTTCAAGGATCGCTAAAGGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTATCGTGCTGAAGGAGAAGTATGGTCCCAATCTAAATCAACTTACATCAGAGAAAATCACTATTGTCGACGGAGACATTTGCCTTCTAAATGACTCTCATCTTAGAGAACGTATGCAAAAAGAAATAGATATTGTTGTCAATGTTGCAGCCACAACAAACTTTGACGAAAGATATGATGTTGGGCTTGGGATCAATACATTTGGAGCTCTCAACGTCCTTAACTTTGCCAAAAAATGTGTTAAAGTTCAATTGCTTCTCCATGTCTCAACTGCTTATGTTTGTGGAGAAAAGCCAGGTCTCATACCTGAAAAACCATTCATCATGGAAGAGATTCGTAACGAGAATGGTCTTCAATTGGATATTAACCTTGAAAGGGAGCTTATGAAATTGGTTCAGGAGAAACTTGACCAGCTCCGAGTAAACGGAGCCGCTCCTGAAACCATCACGGAAACCATGAAGGATCTCGGACTCAGACGGGCAAAGATGTACGGATGGCCAAACACATATGTGTTATCGGTGAGCCCTCTCAGAACAGCATCGCACCAAAGCAATGGGGGAGATGATGGTAGGGACAAAAAGAGAAAAATCGCGCGCCTCTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCAGCCCATCAATAGAGCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTCAACCTCATCGTCTGTCACTTGTGTTGCTTCGTCCTTCAATTATTACCAGCACATTCAAAGAACCATTTCCTGGTTGGACTGAGGGCATCAGGACTATTGATAGTTTAGCTGTTGGATATGGCAAAGGCAAACTCACGGTCGATGTTAACTCGGTCTGCGATATGATACCAGTGGATATGGTGGCAAACGCAATGATCACGGCTGCAGCCAAACACGCTGGAGGTTCAGGGGTTCACATGGTGTACCATGTCGGCTCATCTCACCAGAACCCAGTCACATTTGGAGAGATTCATGAGATTGCGGTTCGTTACTTTACGAAAAACCCTTTGCGAAGTCGCAATGGCTCACTCATAACCGTCTCAAAAGTGAGGTTCATACCAACCATGGCTTTGTTCAGCCTCTACATGACCCTACGTTACAAACTACCTCTCCAGTTATTAAAACTAGTTGACATAACATATCCTTGGAGAAACGGAGATAAATATGGAGACAAGAACCGCAAACTCGAGTTGGTGATGAGATTGGTAGAGCTTTATGATCGTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCAGCCCATATCGAGCCTTATGTACTCTTCAAGGGAATATTCGACGATAGAAATACAAAGAGTTTATGCGCAAACCAGAAGGAAGAGGAGATCAAAAATACAGAAAAATTGATGTTTGATTTCGACCCAAAAGGAATTAATTGGGGAGATTATCTCACTAAAATACACATTTCTGGACTCGTCACACACGTGCTTAAGAAGTGATGTTGAAATAAAGTTCCAGGGGATGACCTTACTATGGTCGGGAGGTCACGTCGCCGTTCAGAACACGCATCAGCAGCATACAAGTCTAGCAGCCGTGATGTCTGTGTCCCTGAACCTCCCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTCAACCTCCGCTCGGCTCGGGTACCTCGGTTTCATCCCGGACTATCCCGCGACGTAATCTCTACGCGTCCCCGCCAGACAGCTAGATTTTGTTTTCTTATAAAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCGCCTACGTAGCAATCCGATAGCCCATCAATAGAGCATGGGCCGGAACTTCGATGCTCTCCCAGATGAGGGGACCAGCAGTCCGATGATTCAAGAGGTTCCAGGGGATGACCTTACTATGGTCGGGAGGTCACGTCGCCGTTCAGAACACGCATCAGCAGCATACAAGTCTAGCAGCCGTGATGTCTGTGTCCCTGAACCTCCCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTATCGCAACCTCCGCTCGGCTCGGGTACCTCGGTTTCATCCCGGACTATCCCGCGACGTAATCTCTACGCGTCCCCGCCAGACAGCTAGATTTTGTTTTCTAAAGGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGCAACGCGTCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCGCCTACGTAGCAATCCGATAGCCCATCAATAGAGCATGGGCCGGAACTTCGATGCTCTCCCAGATGAGGGGACCAGCAGTCGATTCAAGAGCCGACGCTGGCGTGCAGgccCCCGCTATATCTCTAAGTTTGGTTATAAACGGCGGCCCGAATGTTTTGTCTATTTATGCCTCTCTTTGATGTTTTGGGCGATACACAAAACCCAAACTCATGGGAACTCCAAAAGAAGATTCGTTTGAGTGCAGGGATCGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCGCCTCTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCGCCTACGTAGCAATCCGATAGCCCATCATCGGAACGGAAGAGAGTGCCGGAGTTTGTGTTCTTAGCTCACGGAGTTGATGTAATGTCGGCGATGCATGCACCGTTCGTGTTCAGATCTTTTGCTTCAATGCCATCTACCACAAGGATATTCTTGCTACCGATGTGGCCATTCACGTTCTGTGTTATGTTGGGCATGTGGGCTTGGTCAAAGACTTTTCTTTTCAGCTTCTATTCCCTCAGGAACAATCTTTGTCAGACTTGGGGCGTTCCTAGATTCGGATTCCAATACTTCTTACCGATTGCTACAAAAGGAATTAATGATCAAATTGAGGCTGCGATTCTTAGAGCTGATAAGATTGGTGTTAAAGTTACAAGCTTGGCTGCTCTCAACAAGAACGAAGCTCTAAATGGTGGTGGAACACTGTTTGTCAACAAGCATCCTGACCTTAGAGTTCGTGTGGTTCATGGGAACACTTTAACTGCAGCAGTGATTCTCTATGAAATTCCAAAAGATGTGAATGAGGTTTTCTTGACTGGATAATGAAATAAAGCAGCATACAAGTCTAGCAGCCGTGATGTCTGTGTCCCTGAACCTCCCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTCAACCTCCGCTCGGCTCGGGTACCTCGGTTTCATCCCGGACTATCCCGCGACGTAATCTCTACGCGTCCCCGCCAGACAGCTAGATTTTGTTTTCTAAAGGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCGCCTCTTTTATAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCGCCTACGTAGCAATCCGATAGCCCATCAATAGAGCCAAAGCTTGACAACAGTAGAGGCCTTCAACCTCCGCTCGGCTCGGGTACCTCGGTTTCATCCCGGACTATCCCGCGACGTAATCTCTACGCGTCCCCGCTATAAAGCTAGATTTTGTTTTCTAAAGGAAAGTACAGGAGTCCATTATGACGTAGCAATCCGATAGCCCATCAATAGAGCATGGGCCGGAACTTCGATGCTCTCCCAGATGAGGGGACCAGCAGTCGATTCAAGAGCCGACGCTGGCGTGCAGCCCGCCGCGTCTCTAAGTTTGGTAAAGTACAGGAGTCCATTATGCGCGTCCATGGGCCGGAACTTCGATGCTCTCCCAGATGAGGGGACCAGCAGTCGATTCAAGAGTTTATTGTCTGTTCAGTTGGTCCCCATTTCTTGATGATGCAGACTATGGTACGTTGGAGTACGGGTGAGATATCGTAAGACTGGAAGAATCTCGAACAGCTTGTGAGAGAATATCTCAACGTTACAATGTCCTAAACACCTCATGAAATCAAACATAACAGCGTACGATACACGCTGGAGGTTCAGGGGTTCACATGGTGTACCATGTCGGCTCATCTCACCAGAACCCAGTCACATTTGGCGATACCGTAGATCGCACTTAATGATCCAACACCAAACAAGCAACATCCAATCAATGGAACACCAGCTACGACACAGAGGATAATGTTTTCCAATAACGTTGCGTTTCCAGCAGTCATGGGATGTGGAACAGGAGATGAGTGGTGGAAAGAGTGCATACTGGGCTACTTTTATAGCAGCATACAAGTCTATAAGCCGTGATGTCTGTGTCCCTGAACCTCCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGATCCCGCGACGTAATCTCTACGCGTCCCCGCCAGACAGCTAGATTTTGTTTTCTAAAGGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGTATATTGGGCAGAAGACTATAAACCAGTCTTCGCCATGGCCACTTCTAAGCTGGGAAGAGCTATTGCTCTTTACCTTTGTCGCCGTGGAGTGAGAGTTCTCATGTTGACATTGTCTATGGAAAGGTTCCAAAAGATTCAGAAAGAGGCTCCTGTTGAGTTCCAGAACAACCTTGTACAAGTGACCAAATACAATGCTGCTCAACACTGCAAGACTTGGAAGGTTGGAAAATGGTTAACACCAAGAGAGCAGAGCTGGATCGAACAGCTTTAATCGGCTCCTGCAGGGACGCATTTCCATCAGTTTGTGGTGCCACCAATCCTTAAGTTTAGAAGGAACTGCACTTACGGTGATCTAGCAGCTATGAAGCTCCCTAAAGATGTTGAAGGACTCGGAACTTGCGAGTACACGATGGAGAGAGGGGTGGTACATGCGTGCCATGCAGGAGGAGTGGTTCATAATATCGCTACGCGTCCCCGCCAGACAGCTAGATTTTGTTTTCTAAAGGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCGCCTCTTGGGCAGAAGACGTAACTATCGGCTATGGGGTTGGAAGCATCAATGGGTTGGAGCCATATGTGTATGCCGTGGCGATTTGGTGTGGGAAGCAGCCATGAAGTATGGTCTATGTGCTGTTTCTTCACTCACAAAATCTGAACACTAATAAAGCATCTCAGAGTAGTGACAAGGTTGACCAGCCAGCACTCTACGCAGAGGGCAATGATGTCGGAGCTCATGCCCGAGTCGCAATGGCAAACGTGCACCAACGGACCACAGACGGGAACAGCTTTACTTGTTGATTTCGAGCTCGATTAGAATAGGCCCCCTGTAGGTATGATTGTAGCGAGATGGGAGGTTCCGCGCCAGCTAAGAGATTGGTTTTCACCGACCGGGCTTGGATAGTGCTAGCTTACCCCCACGTCTTTCCACCTAAGTGCATGAGTCTGCAGTGGAACGCCGGCCGCTAACCTCCGCACTCACACGCATACTCTACCGATAATCGGATCAGAGGAGGCCTAAGTCTCTGCGGAAGTTCCAGGGGATGACCTTACTATGGTCGGGAGGTCACGTCGCCGTTCAGAACACGCATCAGCAGCATACAAGTCTAGCAGCCGTGATGTCTGTGTCCCTGAACCTCCCCAAAGCGGGAGTTGACAACAGTAGAGGCCTTCAACCTCCGCTCGGCTCGGGTACCTCGGTTTCATCCCGGACTATCCCGCGACGTAATCTCTACGCGTCCCCGCCAGACAGCTAGATTTTGTTTTCTAAAGGAAAGTACAGGAGTCCATTATGCGCGTCCTGTCTGAGCCGAGAGCAACTTGGGCAGAAGACGTAACTG
Homework Answers
Total ATGs--- 164
5'-ATG-3' start codon Open Reading Frames- 134
- ATGGGGGAGATGATGGTAGGGACAAAAAGAGAAAAATCGCGCGCCTCTTGGGCAGAAGACGTAACTGGTGAGCCCTCTCAGAACAGCGCAGCCCATCAA
- ATGATGCAGACTATGGTACGTTGGAGTACGGGTGAGATATCG
( underlines are start codon ATG, than the bold ATGs are present as a motif in reading frame)
you can copy these sequences and ctrl+F to find the it in the whole sequence given on the question.
Add Answer to:
9.) How many times does the motif 5’-ATG-3’ appear in the whole
sequence? How many times...
Use python! Average length to an ATG Please put all of your code for this problem...
Use
python!
Average length to an ATG Please put all of your code for this problem in a file called lengthTOATG.py Let's assume that we have a long DNA sequence in which each symbol is random and equally likely to be an A, C, T, or G. We'd like to determine the average number of symbols until we see the first occurrence of a start codon "ATG" Once you've written a function to compute this, you'll do the same thing...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
where does transcription begin 3. List the major types of RNA and include what they code...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
1. How many Timers does the F5529 have? Name them. What happens when the Timer overflows?...
1. How many Timers does the F5529 have? Name them. What happens when the Timer overflows? And what exactly does "overflow" mean? 2. What is the name of the register that "counts?" 3. 4. What is the name of the Timer A Interrupt Flag? 5. What is "resolution?" State 2 ways you can change it. What are the different Timer Modes and how do they work? 6. 7. What is the advantage of Up Mode vs Continuous Mode? What settings...
GOT THE CONCEPT? 2-9 How Many Times Does It Pass? You throw a ball straight upward...
GOT THE CONCEPT? 2-9 How Many Times Does It Pass? You throw a ball straight upward at an initial speed of 5.00 m/s. How many times does the ball pass through a point 2.00 m above the point where it left your hand? Ignore the effects of air resistance. (a) Two; (b) one; (c) zero; (d) not enough information given to decide.
no explanation needed just need answer for each box QUESTION 8 How many grams does 5.60...
no explanation needed just need answer for each box
QUESTION 8 How many grams does 5.60 x 1022 molecules of SiO2 weigh? QUESTION 9 How many grams are in 8.13 x 1023 molecules of CH4? QUESTION 10 How many grams does 0.500 moles of copper (1) bromide weigh?
Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with...
Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with your code. Notice that we included test cases under every function. If you run the project_01_template.py file at this point it should print False for each test. After you write the correct code for each function, and then run the file, it should print True for each test. 1. Write a function named gc_content that takes one argument sed and performs the following tasks:...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
9. Imagine an organism with a diploid number of 16. How many chromosomes would be present...
9. Imagine an organism with a diploid number of 16. How many chromosomes would be present in a typical cell during the G1 phase of the cell cycle? (Just give a number!) 10. Imagine an organism with a diploid number of 16. How many chromatids would be present during the G1 phase of the cell cycle? (Just give a number!) (2) 11. Imagine an organism with a diploid number of 16. How many chromatids would be present just before the...
in Python Objective: Practice Displaying Output with print Function, Comments, Variable, Reading Input from the Keyboard,...
in Python
Objective: Practice Displaying Output with print Function, Comments, Variable, Reading Input from the Keyboard, format output, if statement, if-else statement, loop structure. import, functions, file handling. and string methods. Lab Description: You are given a file containing protein sequences with the task of finding motifs. Motifs are certain patterns of amino acids that appear many times in protein sequences that act as indictors or markers for special regions, genes, mutations, etc. An example of what this file will...
Use
python!
Average length to an ATG Please put all of your code for this problem in a file called lengthTOATG.py Let's assume that we have a long DNA sequence in which each symbol is random and equally likely to be an A, C, T, or G. We'd like to determine the average number of symbols until we see the first occurrence of a start codon "ATG" Once you've written a function to compute this, you'll do the same thing...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
1. How many Timers does the F5529 have? Name them. What happens when the Timer overflows? And what exactly does "overflow" mean? 2. What is the name of the register that "counts?" 3. 4. What is the name of the Timer A Interrupt Flag? 5. What is "resolution?" State 2 ways you can change it. What are the different Timer Modes and how do they work? 6. 7. What is the advantage of Up Mode vs Continuous Mode? What settings...
GOT THE CONCEPT? 2-9 How Many Times Does It Pass? You throw a ball straight upward at an initial speed of 5.00 m/s. How many times does the ball pass through a point 2.00 m above the point where it left your hand? Ignore the effects of air resistance. (a) Two; (b) one; (c) zero; (d) not enough information given to decide.
no explanation needed just need answer for each box
QUESTION 8 How many grams does 5.60 x 1022 molecules of SiO2 weigh? QUESTION 9 How many grams are in 8.13 x 1023 molecules of CH4? QUESTION 10 How many grams does 0.500 moles of copper (1) bromide weigh?
Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with your code. Notice that we included test cases under every function. If you run the project_01_template.py file at this point it should print False for each test. After you write the correct code for each function, and then run the file, it should print True for each test. 1. Write a function named gc_content that takes one argument sed and performs the following tasks:...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
in Python
Objective: Practice Displaying Output with print Function, Comments, Variable, Reading Input from the Keyboard, format output, if statement, if-else statement, loop structure. import, functions, file handling. and string methods. Lab Description: You are given a file containing protein sequences with the task of finding motifs. Motifs are certain patterns of amino acids that appear many times in protein sequences that act as indictors or markers for special regions, genes, mutations, etc. An example of what this file will...
Most questions answered within 3 hours.
-
please don't use the p value method instead use the "5 steps of
hypothesis testing." Or...
asked 8 minutes ago -
It is said that Galileo discovered a basic principle of the
pendulum—that the period is independent...
asked 14 minutes ago -
The Cost of Equity and
Flotation Costs
Messman Manufacturing
will issue common stock to the public...
asked 21 minutes ago -
a) summarize the challenges facing New Britain today
b) identify some of its strengths
c) suggest...
asked 23 minutes ago -
**86 at 40 not 88. please show how got Tr in calculations thank
you
2) The...
asked 23 minutes ago -
McGlaun Company pays its employees every two weeks. The firm
last paid its employees on September...
asked 37 minutes ago -
You have been gifted a Mogwai as a pet and decide to do a little
online...
asked 42 minutes ago -
given the standard of 200 mg/dl and the absorbance of that
standard is 0.640. What is...
asked 44 minutes ago -
Exercise 8-51 Algo
An accounting professor is notorious for being stingy in giving
out good letter...
asked 52 minutes ago -
month
total distribution cost
level of activity (unit produced)
july
230.000
3500
august
250.000
3750
september...
asked 54 minutes ago -
A smoke detector system uses two devices, A and B. If smoke is
present, the probability...
asked 1 hour ago -
Your division head has assigned another important project to you
and your team. This project is...
asked 1 hour ago