Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...

Question

Question

Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...

Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme recognizes specific nucleotide sequences?

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

after the restriction enzyme recognise the restriction site

cleavage of the restriction site occur
sticky ends are formed
annealing of the gene of insert to the site where restriction enzyme made a cut.
dna ligase is required to seal the gap.

Add a comment

Answer 2

Similar Homework Help Questions

14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA...

14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA b. Can be used to ligate DNA ends C. Recognizes palindromic DNA sequences d. Cuts random sequences of DNA
RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To...

RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To begin the recombinant DNA process, scientists must first ide at codes for the production of the protein they want to manufacture. One is to go backwards from the amino acid sequence of the desired protein to ide sequence of the gene. After scientists have identified the gene, they m it. Restriction enzymes or endonucleases from bacterial cells are key in th ia produce restriction...
find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...

find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...

1.) If we mix two restriction fragments cut with the same restriction enzyme in the presence of DNA ligase, ATP and appropriate buffer, we will obtain... A) protein B) carbohydrate C) recombinant DNA...

1.) If we mix two restriction fragments cut with the same restriction enzyme in the presence of DNA ligase, ATP and appropriate buffer, we will obtain... A) protein B) carbohydrate C) recombinant DNA or plasmid D) pAMP
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...

1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
Restriction endonucleases are: [ can be more than one] Scientists received Nobel Prize in 1978 for...

Restriction endonucleases are: [ can be more than one] Scientists received Nobel Prize in 1978 for discovering restriction endonucleases. Bacteria keeps their own DNA modified preventing digestion by their own enzyme. Enzymes found in bacteria that digests DNA. Each restriction enzyme recognizes a specific DNA sequence. Bacteria uses their own restriction enzymes for their defense against viral infection. Which of the following is/are correct for chemical synthesis of oligo DNA? answer can be more than one Any nucleotide is added...

1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called...

1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
Identify each figure in the following diagram which depicts the generation of a recombinant plasmid from...

Identify each figure in the following diagram which depicts the generation of a recombinant plasmid from plasmid and donor DNA. The orange and yellow balls are protein molecules. Identify each feature in the following diagram which depicts the generation of a recombinant plasmid from plasmid and donor DNA. The orange and yellow bals are protein molecules. recombinant plasmid restriction enzyme DNA ligase restriction site ligation G AA CTTAA C. Plasmid DNA AATTC CTTAA
Which statement best describes restriction enzymes? View Available Hint(s) Which statement best describes restriction enzymes? They...

Which statement best describes restriction enzymes? View Available Hint(s) Which statement best describes restriction enzymes? They randomly cut DNA molecules to generate numerous fragments. They are necessary for the polymerase chain reaction (PCR) to occur. They are important for cloning applications because they can be used to cut DNA at specific nucleotide sequences. They can cut only circular plasmid DNA.

CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that...

CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check

Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...

Homework Answers

Add Answer to:
Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...

Post as a guest

Earn Coins

14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA...

RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To...

find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...

1.) If we mix two restriction fragments cut with the same restriction enzyme in the presence of DNA ligase, ATP and appropriate buffer, we will obtain... A) protein B) carbohydrate C) recombinant DNA...

1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...

Restriction endonucleases are: [ can be more than one] Scientists received Nobel Prize in 1978 for...

1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called...

Identify each figure in the following diagram which depicts the generation of a recombinant plasmid from...

Which statement best describes restriction enzymes? View Available Hint(s) Which statement best describes restriction enzymes? They...

CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that...

Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...

Homework Answers

Add Answer to: Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...

Post as a guest

Earn Coins

Add Answer to:
Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...