Homework Answers
Answer - (c)
A restriction enzyme is a protein which is used as a molecular scissors to cut the DNA at a specific site and to recognize palindromic DNA sequence.
Thank you
Add Answer to:
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA...
Use a web search to determine where (in terms of the DNA sequence) the restriction enzyme...
Use a web search to determine where (in terms of the DNA sequence) the restriction enzyme BamH1 cuts the DNA.
find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate...
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...
Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme recognizes specific nucleotide sequences?
Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
9. An alteration in the nucleic acid sequence in which a specific restriction endonuclease cuts can...
9. An alteration in the nucleic acid sequence in which a specific restriction endonuclease cuts can be detected by a. ELISA b. flow cytometry c. RFLP d. FISH 10. Which of the following techniques enables the identification of a particular sequence of nucleic acid on a cell or tissue? a. northern blot b. western Blot c. FISH d. southern blot 11. The polymerase chain reaction is used to a. convert RNA back into DNA b. amplify a target nucleic acid...
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
Most questions answered within 3 hours.
-
What would you expect the observed boiling point to be at 10
torrs of a liquid...
asked 3 minutes ago -
write a javascript jquery code to display calendar and let it be
sticked on the textbox...
asked 11 minutes ago -
A Call Spread is
A.
The simultaneous purchase of a call and
sale of a put...
asked 10 minutes ago -
In response to concerns about a future recession, the government
decides to give consumers a tax...
asked 12 minutes ago -
Experimental studies of cancer often use strains of animals that
have a naturally high incidence of...
asked 17 minutes ago -
Sociology Question Emile Durkheim
What role does mass media play in the lives of contemporary
citizens?...
asked 22 minutes ago -
Why would you silence gene expression for both wild-type and
mutants? I am on a question...
asked 31 minutes ago -
While all of the elements below are helpful, Booth et al. (2008)
emphasize that it is...
asked 36 minutes ago -
2. Use the three-step method to analyze the effects of the event
on the equilibrium price...
asked 36 minutes ago -
Draw a Venn diagram of three domains of life and explain.
asked 40 minutes ago -
In testing a new drug, researchers found that 5% of all patients
using it will have...
asked 1 hour ago -
List the six general types of information management systems,
and give one logistics application to each...
asked 59 minutes ago