If a strand of DNA of sequence 5’-TGGACCTAGACC-3’ is replicated, which of the following accurately represents...
If a strand of DNA of sequence 5’-TGGACCTAGACC-3’ is replicated, which of the following accurately represents the newly synthesized DNA strand?
A. 3’-ACCTGGATCTGG-5’
B. 5’-ACCTGGATCTGG-3’
C. 5 -’ACCUGGUTCTGG - 3'
D. 3’-ACCUGGUTCTGG-5'
Homework Answers
In this case, the replication occurs from 5’ to 3’ direction and the newly strand will have be read in 3’ to 5’ direction. So, B and C are not correct. In the replication process, we are forming a DNA strand, not a RNA strand (RNA has U on its sequence), so the option D is incorrect.
The correct answer is A
Add Answer to:
If a strand of DNA of sequence 5’-TGGACCTAGACC-3’ is replicated,
which of the following accurately represents...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
in the figure below, the dashed line represents a newly synthesized DNA strand while the solidines...
in the figure below, the dashed line represents a newly synthesized DNA strand while the solidines represent parental/template DNA strands. The polarity for one parental strand is given the direction of the replication fork is indicated with an arrow. With respect to this replication fork, in which direction would helicase be working? A B C D Direction of replication
6. A strand of DNA of the following sequence (isted according to convention) is synthesized: d(AGCTTCCAGCTAGCCTTA...
6. A strand of DNA of the following sequence (isted according to convention) is synthesized: d(AGCTTCCAGCTAGCCTTA a. What DNA strand would hydribize to this sequence? b. What RNA strand would hybridize to the same synthesized sequence?
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of...
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'
Is the following statement true or false? “When read in the same direction (5’→3’), the sequence...
Is the following statement true or false? “When read in the same direction (5’→3’), the sequence of nucleotides in a newly synthesized DNA strand is the same as in the parental “template strand.”
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
Give the sequence of the complementary strand of the following DNA of one DNA strand of...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
A strand of DNA has the base sequence GATTCA
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
The following is a strand of DNA. What would be the sequence of the complimentary strand...
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
in the figure below, the dashed line represents a newly synthesized DNA strand while the solidines represent parental/template DNA strands. The polarity for one parental strand is given the direction of the replication fork is indicated with an arrow. With respect to this replication fork, in which direction would helicase be working? A B C D Direction of replication
6. A strand of DNA of the following sequence (isted according to convention) is synthesized: d(AGCTTCCAGCTAGCCTTA a. What DNA strand would hydribize to this sequence? b. What RNA strand would hybridize to the same synthesized sequence?
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
Most questions answered within 3 hours.
-
I propose to you a game. You roll 2 dice. If the sum of the
numbers...
asked 15 minutes ago -
Select the most likely lattice types for each of the following
salts: (a) BeF2; (b) CaO;...
asked 20 minutes ago -
a
ball is thrown downward with velocity of 10m/s. calculate the final
velocity if it reaches...
asked 58 minutes ago -
How many grams of ice at -15°C must be added to 705 grams of
water that...
asked 2 hours ago -
2. Balance sheet
The balance sheet provides a snapshot of the financial condition
of a company....
asked 2 hours ago -
In week 1 of the chemical equilibrium experiment, you and your
lab team will create a...
asked 3 hours ago -
Identify and describe five (5) characteristics of a good KM
measurement system. Be sure to include...
asked 3 hours ago -
What are at least five (5) workplace wellness best practices for
a successful wellness program? Explain...
asked 3 hours ago -
A pharmaceutical company is testing a new drug. Of the 110
people that received the drug,...
asked 3 hours ago -
Which of the following is NOT a mechanism for gene
regulation?
a. Phase variation in DNA....
asked 3 hours ago -
Which of the following is being applied when, under certain
conditions, the value recorded for an...
asked 3 hours ago -
Describe the role of the three components of connective
tissue. In what ways does a connective...
asked 3 hours ago