An RNA molecule has the following sequence: ’UCAAUGCUUAAGAAGGCAUGAAAUAA 3’ Label the protein-coding region of this mRNA,...
An RNA molecule has the following sequence: ’UCAAUGCUUAAGAAGGCAUGAAAUAA 3’ Label the protein-coding region of this mRNA, and any other region(s) that are
present. What is the sequence of the polypeptide it codes for?
Homework Answers
The start codon, protein coding region and stop codon are marked below:
the
sequence of the polypeptide it codes for is :
AUG - methionine
CUU - leucine
AAG - lysine
AAG - lysine
GCA - alanine
Which can also be written as - methionine - leucine - lysine - lysine - alanine
OR
met—leu-lys-lys-ala
Add Answer to:
An RNA molecule has the following sequence:
’UCAAUGCUUAAGAAGGCAUGAAAUAA 3’ Label the protein-coding region of
this mRNA,...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase)...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase) (2) f. Assume that a fish inherits a deletion mutation in the pituitary switch such that the switch becomes inactive. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect the pituitary switch mutation? (2)
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
You are given the following sequence of DNA which encodes for a short protein (this is...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid...
In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid sequence of a protein. a) Transcription b) Translation c) Coding d) None of the above
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase) (2) f. Assume that a fish inherits a deletion mutation in the pituitary switch such that the switch becomes inactive. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect the pituitary switch mutation? (2)
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Most questions answered within 3 hours.
-
Kylie is a single mom with two dependent children,
Tanner, age 7 and Olivia, age 11....
asked 43 minutes ago -
Phosphorous + bromine = phosphorous tribromide. If 35.0 g of
bromine are reacted and 27.9 grams...
asked 2 hours ago -
Derive the long wavelength limit of the Planck energy density
distribution
asked 1 hour ago -
Calculate the pH of each of the following solutions.
0.50 M HBr
3.1×10−4 M KOH
4.2×10−5...
asked 5 hours ago -
For the year ended December 31, Depot Max’s cost of merchandise
sold was $85,600. Inventory at the...
asked 5 hours ago -
Week 10 - Professional Memo Assignment
Professional Memo Assignment
Your mission for this week, should you...
asked 5 hours ago -
Write a Python program that stores the data for each
player on the team, and it...
asked 5 hours ago -
In
the last 3 months, mike never knows when he is going to get his
allowance...
asked 6 hours ago -
Is Ca(OH)2 a Bronsted base, Lewis base, or both? Why?
asked 6 hours ago -
1A- Why don’t voters complain about U.S. tariffs on imported
sugar?
Because sugar is only a...
asked 6 hours ago -
Cash Payback Period
Primera Banco is evaluating two capital investment proposals for
a drive-up ATM kiosk,...
asked 6 hours ago -
Create a button in Swift (Xcode) that will create a charge,
create a charge using Stripe's...
asked 6 hours ago